FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633758_at:

>probe:Drosophila_2:1633758_at:101:39; Interrogation_Position=1094; Antisense; ATCTGTATGTGATTGCCGGCGTTGC
>probe:Drosophila_2:1633758_at:267:525; Interrogation_Position=1122; Antisense; GGGCATAGCCTTGCTGCAGTTGTTC
>probe:Drosophila_2:1633758_at:622:265; Interrogation_Position=1138; Antisense; CAGTTGTTCGTCATCTATTTGGCCA
>probe:Drosophila_2:1633758_at:584:323; Interrogation_Position=642; Antisense; GCGCGAGAACACCTGGCTGCTAAAG
>probe:Drosophila_2:1633758_at:653:571; Interrogation_Position=656; Antisense; GGCTGCTAAAGCTGTACTCCATGTG
>probe:Drosophila_2:1633758_at:220:285; Interrogation_Position=682; Antisense; CTGCTTCTCTTCTTCATACTGGAGA
>probe:Drosophila_2:1633758_at:43:349; Interrogation_Position=738; Antisense; GCAGTACATGAACTCGTTCCTCGAG
>probe:Drosophila_2:1633758_at:28:513; Interrogation_Position=797; Antisense; GTGACGACTCCGACTTGCAAAACTT
>probe:Drosophila_2:1633758_at:342:77; Interrogation_Position=839; Antisense; AGGAGTTTAACTGCTGCGGCCTGAG
>probe:Drosophila_2:1633758_at:467:111; Interrogation_Position=862; Antisense; AGCAACGCCGGCTACCAGGATTGGA
>probe:Drosophila_2:1633758_at:144:427; Interrogation_Position=927; Antisense; GAGATGTGGAGTGCCCTACAGCTGC
>probe:Drosophila_2:1633758_at:353:335; Interrogation_Position=947; Antisense; GCTGCTGTATTAATGCCACCGATAT
>probe:Drosophila_2:1633758_at:328:35; Interrogation_Position=970; Antisense; ATCAGCTCCGGCCTAGTGAACATCA
>probe:Drosophila_2:1633758_at:223:191; Interrogation_Position=988; Antisense; AACATCATGTGTGGCTATGGCGTGC

Paste this into a BLAST search page for me
ATCTGTATGTGATTGCCGGCGTTGCGGGCATAGCCTTGCTGCAGTTGTTCCAGTTGTTCGTCATCTATTTGGCCAGCGCGAGAACACCTGGCTGCTAAAGGGCTGCTAAAGCTGTACTCCATGTGCTGCTTCTCTTCTTCATACTGGAGAGCAGTACATGAACTCGTTCCTCGAGGTGACGACTCCGACTTGCAAAACTTAGGAGTTTAACTGCTGCGGCCTGAGAGCAACGCCGGCTACCAGGATTGGAGAGATGTGGAGTGCCCTACAGCTGCGCTGCTGTATTAATGCCACCGATATATCAGCTCCGGCCTAGTGAACATCAAACATCATGTGTGGCTATGGCGTGC

Full Affymetrix probeset data:

Annotations for 1633758_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720