FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633760_at:

>probe:Drosophila_2:1633760_at:615:653; Interrogation_Position=408; Antisense; TAATTGCACGGCAGCTGAGGCCATC
>probe:Drosophila_2:1633760_at:269:311; Interrogation_Position=462; Antisense; CCAAAAGCATGGTGTGCGCGTCCGG
>probe:Drosophila_2:1633760_at:596:603; Interrogation_Position=528; Antisense; TGTTGCGCCGAGTGCTGTCGTCAAA
>probe:Drosophila_2:1633760_at:540:607; Interrogation_Position=585; Antisense; TGAGATCTCATTGGGCGACACCATT
>probe:Drosophila_2:1633760_at:161:5; Interrogation_Position=607; Antisense; ATTGGTGTGGGCACTCCAGGCACAA
>probe:Drosophila_2:1633760_at:540:69; Interrogation_Position=659; Antisense; AGGTCGTCCCGGCTAAAGATCTGGC
>probe:Drosophila_2:1633760_at:411:145; Interrogation_Position=689; Antisense; ACTGCCACGACACTTATGGTCAGGC
>probe:Drosophila_2:1633760_at:75:71; Interrogation_Position=710; Antisense; AGGCTCTGAGCAACATACTGGTCTC
>probe:Drosophila_2:1633760_at:295:497; Interrogation_Position=730; Antisense; GTCTCACTGGACTATGGCATTCGGG
>probe:Drosophila_2:1633760_at:54:443; Interrogation_Position=829; Antisense; GATGTGGTCTACTTACTGCACGGCA
>probe:Drosophila_2:1633760_at:395:347; Interrogation_Position=851; Antisense; GCATGGGCCTCGATACTGGCGTCAA
>probe:Drosophila_2:1633760_at:398:287; Interrogation_Position=866; Antisense; CTGGCGTCAACCTAGACAAACTGAT
>probe:Drosophila_2:1633760_at:38:539; Interrogation_Position=902; Antisense; GGTACATCTGCACCGAACTGGGCAG
>probe:Drosophila_2:1633760_at:383:195; Interrogation_Position=917; Antisense; AACTGGGCAGAACCTCAGAGTCCAA

Paste this into a BLAST search page for me
TAATTGCACGGCAGCTGAGGCCATCCCAAAAGCATGGTGTGCGCGTCCGGTGTTGCGCCGAGTGCTGTCGTCAAATGAGATCTCATTGGGCGACACCATTATTGGTGTGGGCACTCCAGGCACAAAGGTCGTCCCGGCTAAAGATCTGGCACTGCCACGACACTTATGGTCAGGCAGGCTCTGAGCAACATACTGGTCTCGTCTCACTGGACTATGGCATTCGGGGATGTGGTCTACTTACTGCACGGCAGCATGGGCCTCGATACTGGCGTCAACTGGCGTCAACCTAGACAAACTGATGGTACATCTGCACCGAACTGGGCAGAACTGGGCAGAACCTCAGAGTCCAA

Full Affymetrix probeset data:

Annotations for 1633760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720