FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633761_at:

>probe:Drosophila_2:1633761_at:288:103; Interrogation_Position=300; Antisense; AGAGCGATCCATACGCCGGTGAAGT
>probe:Drosophila_2:1633761_at:118:635; Interrogation_Position=354; Antisense; TCGCCGACTGTGAGCCGTGGACTGA
>probe:Drosophila_2:1633761_at:1:75; Interrogation_Position=427; Antisense; AGGACAAGGTCCCTGAGACTCAGCC
>probe:Drosophila_2:1633761_at:694:661; Interrogation_Position=487; Antisense; TAACAGCTTCTACTCCTGGTCTAAA
>probe:Drosophila_2:1633761_at:469:585; Interrogation_Position=503; Antisense; TGGTCTAAACTCTGGCTCCAATTCG
>probe:Drosophila_2:1633761_at:262:573; Interrogation_Position=516; Antisense; GGCTCCAATTCGATGCTGACTACTG
>probe:Drosophila_2:1633761_at:420:609; Interrogation_Position=532; Antisense; TGACTACTGGATCTTCAAGCCCGGG
>probe:Drosophila_2:1633761_at:111:273; Interrogation_Position=587; Antisense; CATTGGCACCAAGGCGAATCTTTTC
>probe:Drosophila_2:1633761_at:515:295; Interrogation_Position=611; Antisense; CGACAATTTTACCTTGCCAACGATT
>probe:Drosophila_2:1633761_at:195:625; Interrogation_Position=625; Antisense; TGCCAACGATTTTACCCGATAGAGT
>probe:Drosophila_2:1633761_at:615:361; Interrogation_Position=652; Antisense; GCAAGGATGCTCGTGGTAGCGCAAT
>probe:Drosophila_2:1633761_at:402:373; Interrogation_Position=679; Antisense; GAAGTCATTCTACTCCTAGGATGTA
>probe:Drosophila_2:1633761_at:313:449; Interrogation_Position=712; Antisense; GATCCTATAGCTCGATGGCTGACGC
>probe:Drosophila_2:1633761_at:210:437; Interrogation_Position=742; Antisense; GAGGATCTCCCTCGGTCACAAAGAA

Paste this into a BLAST search page for me
AGAGCGATCCATACGCCGGTGAAGTTCGCCGACTGTGAGCCGTGGACTGAAGGACAAGGTCCCTGAGACTCAGCCTAACAGCTTCTACTCCTGGTCTAAATGGTCTAAACTCTGGCTCCAATTCGGGCTCCAATTCGATGCTGACTACTGTGACTACTGGATCTTCAAGCCCGGGCATTGGCACCAAGGCGAATCTTTTCCGACAATTTTACCTTGCCAACGATTTGCCAACGATTTTACCCGATAGAGTGCAAGGATGCTCGTGGTAGCGCAATGAAGTCATTCTACTCCTAGGATGTAGATCCTATAGCTCGATGGCTGACGCGAGGATCTCCCTCGGTCACAAAGAA

Full Affymetrix probeset data:

Annotations for 1633761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720