Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633763_at:

>probe:Drosophila_2:1633763_at:676:535; Interrogation_Position=290; Antisense; GGTCTTCTCGGTGTGCTTCCAGGAA
>probe:Drosophila_2:1633763_at:661:489; Interrogation_Position=323; Antisense; GTACATCATCTACCGGATACTGCGC
>probe:Drosophila_2:1633763_at:122:281; Interrogation_Position=422; Antisense; CTCCGGCTTGGGATTCGGCATTATA
>probe:Drosophila_2:1633763_at:726:303; Interrogation_Position=448; Antisense; CCGGGATGTTTGCACTGGTCAATGT
>probe:Drosophila_2:1633763_at:370:287; Interrogation_Position=474; Antisense; CTGGCTGATATGAGTGGTCCCGGCA
>probe:Drosophila_2:1633763_at:632:573; Interrogation_Position=513; Antisense; GGCGGAACTGAGCTATTCTTCGTCA
>probe:Drosophila_2:1633763_at:603:69; Interrogation_Position=550; Antisense; AGGCGTTGTCGATTATCCTGCTGCA
>probe:Drosophila_2:1633763_at:294:155; Interrogation_Position=574; Antisense; ACACCTTCTGGAGCGTTATTTTCTT
>probe:Drosophila_2:1633763_at:635:69; Interrogation_Position=632; Antisense; AGGCTATGTGGTTTTCAGCCACCTG
>probe:Drosophila_2:1633763_at:477:605; Interrogation_Position=667; Antisense; TGATAACTCTGCTCAATGCCAATGA
>probe:Drosophila_2:1633763_at:664:47; Interrogation_Position=682; Antisense; ATGCCAATGAGCTTTACACGACCAC
>probe:Drosophila_2:1633763_at:160:293; Interrogation_Position=700; Antisense; CGACCACTCTGCTGATAAACTACTT
>probe:Drosophila_2:1633763_at:706:587; Interrogation_Position=724; Antisense; TGGTCACCATACTTACGGGAGTCCT
>probe:Drosophila_2:1633763_at:730:547; Interrogation_Position=765; Antisense; GGAGGAACATCTCGCAGTTTCAGAA

Paste this into a BLAST search page for me
GGTCTTCTCGGTGTGCTTCCAGGAAGTACATCATCTACCGGATACTGCGCCTCCGGCTTGGGATTCGGCATTATACCGGGATGTTTGCACTGGTCAATGTCTGGCTGATATGAGTGGTCCCGGCAGGCGGAACTGAGCTATTCTTCGTCAAGGCGTTGTCGATTATCCTGCTGCAACACCTTCTGGAGCGTTATTTTCTTAGGCTATGTGGTTTTCAGCCACCTGTGATAACTCTGCTCAATGCCAATGAATGCCAATGAGCTTTACACGACCACCGACCACTCTGCTGATAAACTACTTTGGTCACCATACTTACGGGAGTCCTGGAGGAACATCTCGCAGTTTCAGAA

Full Affymetrix probeset data:

Annotations for 1633763_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime