FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633767_at:

>probe:Drosophila_2:1633767_at:533:573; Interrogation_Position=1812; Antisense; GGCGGCAGCAACGTGGGCAATTCCA
>probe:Drosophila_2:1633767_at:237:363; Interrogation_Position=1828; Antisense; GCAATTCCAACGTTGGCTCGGCCAA
>probe:Drosophila_2:1633767_at:348:233; Interrogation_Position=1851; Antisense; AATGCTGTCGGTGCTTCTCGAAAGT
>probe:Drosophila_2:1633767_at:670:105; Interrogation_Position=1894; Antisense; AGAACGTTCCAATAACCTGCACTTG
>probe:Drosophila_2:1633767_at:31:181; Interrogation_Position=1921; Antisense; AAACACTGCGCGACAAGTTCCGAGA
>probe:Drosophila_2:1633767_at:107:231; Interrogation_Position=1980; Antisense; AATGATGTGGGCGTTGTGCGTTTCT
>probe:Drosophila_2:1633767_at:227:479; Interrogation_Position=1999; Antisense; GTTTCTTTAAGGAGCGCGATGCCGA
>probe:Drosophila_2:1633767_at:564:447; Interrogation_Position=2016; Antisense; GATGCCGAGCTAGCCATTGCGCTTA
>probe:Drosophila_2:1633767_at:559:7; Interrogation_Position=2031; Antisense; ATTGCGCTTATGGATGGCTCCCGTC
>probe:Drosophila_2:1633767_at:137:67; Interrogation_Position=2044; Antisense; ATGGCTCCCGTCTGGATGGGCGCAA
>probe:Drosophila_2:1633767_at:660:701; Interrogation_Position=2113; Antisense; TTATTCTACGTTTCTTGTCGCCAAT
>probe:Drosophila_2:1633767_at:606:597; Interrogation_Position=2128; Antisense; TGTCGCCAATTCACACTTCAAACAG
>probe:Drosophila_2:1633767_at:174:335; Interrogation_Position=2173; Antisense; GCTGATATTCCTTATTTGACTCGCA
>probe:Drosophila_2:1633767_at:475:653; Interrogation_Position=2207; Antisense; TAATTTTGCACCCACTTATTTGAAT

Paste this into a BLAST search page for me
GGCGGCAGCAACGTGGGCAATTCCAGCAATTCCAACGTTGGCTCGGCCAAAATGCTGTCGGTGCTTCTCGAAAGTAGAACGTTCCAATAACCTGCACTTGAAACACTGCGCGACAAGTTCCGAGAAATGATGTGGGCGTTGTGCGTTTCTGTTTCTTTAAGGAGCGCGATGCCGAGATGCCGAGCTAGCCATTGCGCTTAATTGCGCTTATGGATGGCTCCCGTCATGGCTCCCGTCTGGATGGGCGCAATTATTCTACGTTTCTTGTCGCCAATTGTCGCCAATTCACACTTCAAACAGGCTGATATTCCTTATTTGACTCGCATAATTTTGCACCCACTTATTTGAAT

Full Affymetrix probeset data:

Annotations for 1633767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720