FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633768_at:

>probe:Drosophila_2:1633768_at:464:241; Interrogation_Position=3330; Antisense; AATATTTCAATGGTGCAAGGCAAGA
>probe:Drosophila_2:1633768_at:407:663; Interrogation_Position=3363; Antisense; TAAACCCATTGAAACTTCGCTGTAT
>probe:Drosophila_2:1633768_at:570:391; Interrogation_Position=3395; Antisense; GAAAGCTATATGTGCTACTAATACA
>probe:Drosophila_2:1633768_at:722:21; Interrogation_Position=3419; Antisense; ATATATTTCCATCTGAGGCTCATAG
>probe:Drosophila_2:1633768_at:424:285; Interrogation_Position=3431; Antisense; CTGAGGCTCATAGGGCTTACCTGAC
>probe:Drosophila_2:1633768_at:556:341; Interrogation_Position=3445; Antisense; GCTTACCTGACCCTATCTAAATAAT
>probe:Drosophila_2:1633768_at:112:721; Interrogation_Position=3487; Antisense; TTGCGCTTAAGTTTTTATTGTAAAT
>probe:Drosophila_2:1633768_at:144:15; Interrogation_Position=3513; Antisense; ATTATCTCATACTATCATATACAAG
>probe:Drosophila_2:1633768_at:332:705; Interrogation_Position=3575; Antisense; TTATCTTTAGATGTAGAACCGCAGA
>probe:Drosophila_2:1633768_at:206:381; Interrogation_Position=3590; Antisense; GAACCGCAGAAGAAGCAAGCAAAAT
>probe:Drosophila_2:1633768_at:608:421; Interrogation_Position=3639; Antisense; GAGAACTATTTAATTAAGCCTACTT
>probe:Drosophila_2:1633768_at:159:711; Interrogation_Position=3652; Antisense; TTAAGCCTACTTAAGAAGCTCAGAA
>probe:Drosophila_2:1633768_at:94:61; Interrogation_Position=3738; Antisense; ATGTATTGAGCTCTATATATGTGAA
>probe:Drosophila_2:1633768_at:479:221; Interrogation_Position=3764; Antisense; AAGTGGCATATCTATGTGACATATT

Paste this into a BLAST search page for me
AATATTTCAATGGTGCAAGGCAAGATAAACCCATTGAAACTTCGCTGTATGAAAGCTATATGTGCTACTAATACAATATATTTCCATCTGAGGCTCATAGCTGAGGCTCATAGGGCTTACCTGACGCTTACCTGACCCTATCTAAATAATTTGCGCTTAAGTTTTTATTGTAAATATTATCTCATACTATCATATACAAGTTATCTTTAGATGTAGAACCGCAGAGAACCGCAGAAGAAGCAAGCAAAATGAGAACTATTTAATTAAGCCTACTTTTAAGCCTACTTAAGAAGCTCAGAAATGTATTGAGCTCTATATATGTGAAAAGTGGCATATCTATGTGACATATT

Full Affymetrix probeset data:

Annotations for 1633768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720