FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633769_at:

>probe:Drosophila_2:1633769_at:513:451; Interrogation_Position=1014; Antisense; GATCGTGGACACCATGATGTGTGCC
>probe:Drosophila_2:1633769_at:367:457; Interrogation_Position=1078; Antisense; GATAGCGGTGGTCCCTTGATCGTCA
>probe:Drosophila_2:1633769_at:369:545; Interrogation_Position=1104; Antisense; GGATCGCATTTTCCGTTTGGCTGGA
>probe:Drosophila_2:1633769_at:182:573; Interrogation_Position=1122; Antisense; GGCTGGAGTTGTGTCCTTTGGCTAC
>probe:Drosophila_2:1633769_at:232:671; Interrogation_Position=1144; Antisense; TACGGATGTGCCAAGCCAGATGCTC
>probe:Drosophila_2:1633769_at:641:97; Interrogation_Position=1161; Antisense; AGATGCTCCTGGTGTCTATACTCGA
>probe:Drosophila_2:1633769_at:342:637; Interrogation_Position=1182; Antisense; TCGAGTGTCTCGCTATTTGGAATGG
>probe:Drosophila_2:1633769_at:241:671; Interrogation_Position=1218; Antisense; TACGAGGGACTCTTGTTACTGCATA
>probe:Drosophila_2:1633769_at:140:525; Interrogation_Position=678; Antisense; GGGCGTGTCCGTTAGACTATTGCAG
>probe:Drosophila_2:1633769_at:547:449; Interrogation_Position=772; Antisense; GATCCGGTGAGCCTGGTCCATGATA
>probe:Drosophila_2:1633769_at:278:59; Interrogation_Position=791; Antisense; ATGATATAGCCCTCCTGCGATTGGA
>probe:Drosophila_2:1633769_at:643:3; Interrogation_Position=810; Antisense; ATTGGATCAACCCATTCCGCTGGTG
>probe:Drosophila_2:1633769_at:504:573; Interrogation_Position=869; Antisense; GGCTGCAGAACTTCGACTTCCAGAA
>probe:Drosophila_2:1633769_at:140:523; Interrogation_Position=992; Antisense; GGGCCACTTCGTACAGGTCCATGAT

Paste this into a BLAST search page for me
GATCGTGGACACCATGATGTGTGCCGATAGCGGTGGTCCCTTGATCGTCAGGATCGCATTTTCCGTTTGGCTGGAGGCTGGAGTTGTGTCCTTTGGCTACTACGGATGTGCCAAGCCAGATGCTCAGATGCTCCTGGTGTCTATACTCGATCGAGTGTCTCGCTATTTGGAATGGTACGAGGGACTCTTGTTACTGCATAGGGCGTGTCCGTTAGACTATTGCAGGATCCGGTGAGCCTGGTCCATGATAATGATATAGCCCTCCTGCGATTGGAATTGGATCAACCCATTCCGCTGGTGGGCTGCAGAACTTCGACTTCCAGAAGGGCCACTTCGTACAGGTCCATGAT

Full Affymetrix probeset data:

Annotations for 1633769_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720