FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633770_at:

>probe:Drosophila_2:1633770_at:563:649; Interrogation_Position=490; Antisense; TCACCATTGCGATCTTGGCTGTGCA
>probe:Drosophila_2:1633770_at:729:47; Interrogation_Position=518; Antisense; ATGCCAACACCAGCTTGGAGAGGTT
>probe:Drosophila_2:1633770_at:89:69; Interrogation_Position=549; Antisense; ATGGCGCGACGCTGGCATGAAAGAT
>probe:Drosophila_2:1633770_at:670:95; Interrogation_Position=570; Antisense; AGATCCACTGATTTTCTCTTCGGAG
>probe:Drosophila_2:1633770_at:295:167; Interrogation_Position=683; Antisense; AAATGTCCAACATTGCCTCGTACGG
>probe:Drosophila_2:1633770_at:251:109; Interrogation_Position=726; Antisense; AGAATCCCACGATCTTCACATTCAT
>probe:Drosophila_2:1633770_at:590:647; Interrogation_Position=741; Antisense; TCACATTCATGCTCTTTGGTTCGAT
>probe:Drosophila_2:1633770_at:498:541; Interrogation_Position=758; Antisense; GGTTCGATATCTACACCGGTGACAT
>probe:Drosophila_2:1633770_at:502:611; Interrogation_Position=777; Antisense; TGACATCTATTACTTCAGCCGCGGA
>probe:Drosophila_2:1633770_at:49:415; Interrogation_Position=800; Antisense; GAGCCAAACGTTTTCTGCCTGTTGA
>probe:Drosophila_2:1633770_at:652:715; Interrogation_Position=812; Antisense; TTCTGCCTGTTGATGAAGACACCGT
>probe:Drosophila_2:1633770_at:639:211; Interrogation_Position=827; Antisense; AAGACACCGTGGATCGATTGTCCGA
>probe:Drosophila_2:1633770_at:376:605; Interrogation_Position=912; Antisense; TGATATGTGGGCCTTATACCGCGAT
>probe:Drosophila_2:1633770_at:355:673; Interrogation_Position=928; Antisense; TACCGCGATCGGCATTTACAATTTA

Paste this into a BLAST search page for me
TCACCATTGCGATCTTGGCTGTGCAATGCCAACACCAGCTTGGAGAGGTTATGGCGCGACGCTGGCATGAAAGATAGATCCACTGATTTTCTCTTCGGAGAAATGTCCAACATTGCCTCGTACGGAGAATCCCACGATCTTCACATTCATTCACATTCATGCTCTTTGGTTCGATGGTTCGATATCTACACCGGTGACATTGACATCTATTACTTCAGCCGCGGAGAGCCAAACGTTTTCTGCCTGTTGATTCTGCCTGTTGATGAAGACACCGTAAGACACCGTGGATCGATTGTCCGATGATATGTGGGCCTTATACCGCGATTACCGCGATCGGCATTTACAATTTA

Full Affymetrix probeset data:

Annotations for 1633770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720