FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633772_at:

>probe:Drosophila_2:1633772_at:319:43; Interrogation_Position=1058; Antisense; ATCGTCGATGAGGATCGTGCACCCG
>probe:Drosophila_2:1633772_at:352:667; Interrogation_Position=1091; Antisense; TACGGACCACCAGCGGTGGAGTCCA
>probe:Drosophila_2:1633772_at:56:433; Interrogation_Position=1109; Antisense; GAGTCCAGCTACTCCAGTGCTTCCT
>probe:Drosophila_2:1633772_at:121:627; Interrogation_Position=1141; Antisense; TGCCGCTTCCGCTGGTGGATACAAC
>probe:Drosophila_2:1633772_at:256:593; Interrogation_Position=1153; Antisense; TGGTGGATACAACGGTGGCTACAAC
>probe:Drosophila_2:1633772_at:286:571; Interrogation_Position=1193; Antisense; GGCTACAACGGTGGCTACAATGGCG
>probe:Drosophila_2:1633772_at:702:159; Interrogation_Position=1209; Antisense; ACAATGGCGGTTCCAATAGCGGCTT
>probe:Drosophila_2:1633772_at:321:27; Interrogation_Position=1224; Antisense; ATAGCGGCTTCTCAGGTGGATTCAA
>probe:Drosophila_2:1633772_at:358:715; Interrogation_Position=1232; Antisense; TTCTCAGGTGGATTCAATGGCGGCT
>probe:Drosophila_2:1633772_at:663:203; Interrogation_Position=1259; Antisense; AAGCGTGGCGGTATCTTTGAGAAGC
>probe:Drosophila_2:1633772_at:680:515; Interrogation_Position=1286; Antisense; GTGGGCTGCTAGGTGCTCATGTAAC
>probe:Drosophila_2:1633772_at:338:509; Interrogation_Position=1298; Antisense; GTGCTCATGTAACCATAACTCAAAG
>probe:Drosophila_2:1633772_at:45:659; Interrogation_Position=1313; Antisense; TAACTCAAAGCCACTCAAGGACTCC
>probe:Drosophila_2:1633772_at:322:93; Interrogation_Position=943; Antisense; AGTTCCAGTGGTGCGTTACTCAGCC

Paste this into a BLAST search page for me
ATCGTCGATGAGGATCGTGCACCCGTACGGACCACCAGCGGTGGAGTCCAGAGTCCAGCTACTCCAGTGCTTCCTTGCCGCTTCCGCTGGTGGATACAACTGGTGGATACAACGGTGGCTACAACGGCTACAACGGTGGCTACAATGGCGACAATGGCGGTTCCAATAGCGGCTTATAGCGGCTTCTCAGGTGGATTCAATTCTCAGGTGGATTCAATGGCGGCTAAGCGTGGCGGTATCTTTGAGAAGCGTGGGCTGCTAGGTGCTCATGTAACGTGCTCATGTAACCATAACTCAAAGTAACTCAAAGCCACTCAAGGACTCCAGTTCCAGTGGTGCGTTACTCAGCC

Full Affymetrix probeset data:

Annotations for 1633772_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720