FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633775_at:

>probe:Drosophila_2:1633775_at:495:601; Interrogation_Position=4680; Antisense; TGTATGTGTCCAGGTGCTGGCCACA
>probe:Drosophila_2:1633775_at:212:333; Interrogation_Position=4695; Antisense; GCTGGCCACATTTAGCATATTGCTG
>probe:Drosophila_2:1633775_at:509:79; Interrogation_Position=4760; Antisense; AGGTCGGCACAAAGTGGAGCTCACT
>probe:Drosophila_2:1633775_at:347:553; Interrogation_Position=4775; Antisense; GGAGCTCACTGCGTTTTAAATCAAA
>probe:Drosophila_2:1633775_at:567:383; Interrogation_Position=4841; Antisense; GAACTATATTGAGACTTGATGCACT
>probe:Drosophila_2:1633775_at:410:423; Interrogation_Position=4851; Antisense; GAGACTTGATGCACTCATTTTTGCA
>probe:Drosophila_2:1633775_at:667:355; Interrogation_Position=4861; Antisense; GCACTCATTTTTGCATCAATTATAG
>probe:Drosophila_2:1633775_at:638:455; Interrogation_Position=4957; Antisense; GATAAACTGACACAAGCCAAACGAA
>probe:Drosophila_2:1633775_at:497:203; Interrogation_Position=4970; Antisense; AAGCCAAACGAATACACACACAGAA
>probe:Drosophila_2:1633775_at:383:163; Interrogation_Position=5013; Antisense; AAATTAATGACACGCCTTAGCCTAA
>probe:Drosophila_2:1633775_at:248:265; Interrogation_Position=5049; Antisense; CAGACACAAAGAGAGCAAAGCCAAT
>probe:Drosophila_2:1633775_at:159:33; Interrogation_Position=5102; Antisense; ATAATAGCGACTTAACCTATGGCAA
>probe:Drosophila_2:1633775_at:33:127; Interrogation_Position=5116; Antisense; ACCTATGGCAAAACACTCGGCGTTT
>probe:Drosophila_2:1633775_at:89:697; Interrogation_Position=5154; Antisense; TTTAATTTTTAAGCCAATCAGCGAA

Paste this into a BLAST search page for me
TGTATGTGTCCAGGTGCTGGCCACAGCTGGCCACATTTAGCATATTGCTGAGGTCGGCACAAAGTGGAGCTCACTGGAGCTCACTGCGTTTTAAATCAAAGAACTATATTGAGACTTGATGCACTGAGACTTGATGCACTCATTTTTGCAGCACTCATTTTTGCATCAATTATAGGATAAACTGACACAAGCCAAACGAAAAGCCAAACGAATACACACACAGAAAAATTAATGACACGCCTTAGCCTAACAGACACAAAGAGAGCAAAGCCAATATAATAGCGACTTAACCTATGGCAAACCTATGGCAAAACACTCGGCGTTTTTTAATTTTTAAGCCAATCAGCGAA

Full Affymetrix probeset data:

Annotations for 1633775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720