FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633777_at:

>probe:Drosophila_2:1633777_at:493:651; Interrogation_Position=1699; Antisense; TCAACCAGCGGGAGGGTCGTCTCTC
>probe:Drosophila_2:1633777_at:371:57; Interrogation_Position=1729; Antisense; ATGAGAACAAGCTGCGCTTCAAGCG
>probe:Drosophila_2:1633777_at:111:343; Interrogation_Position=1744; Antisense; GCTTCAAGCGGATGATGTCCACCTA
>probe:Drosophila_2:1633777_at:268:443; Interrogation_Position=1757; Antisense; GATGTCCACCTACGGTCTGGATATA
>probe:Drosophila_2:1633777_at:259:589; Interrogation_Position=1774; Antisense; TGGATATACCCATCGACCAGGCGAT
>probe:Drosophila_2:1633777_at:138:623; Interrogation_Position=1833; Antisense; TGCGACGCCAACTTTGATCCGGACG
>probe:Drosophila_2:1633777_at:60:607; Interrogation_Position=1847; Antisense; TGATCCGGACGTGGAGAGTCTGCAC
>probe:Drosophila_2:1633777_at:189:431; Interrogation_Position=1862; Antisense; GAGTCTGCACGCACTGGATCTGTTG
>probe:Drosophila_2:1633777_at:38:61; Interrogation_Position=2063; Antisense; ATGTATATCATCATCCTGAACGGAA
>probe:Drosophila_2:1633777_at:57:391; Interrogation_Position=2085; Antisense; GAAACGGTTTGAATTTGTGGATCTA
>probe:Drosophila_2:1633777_at:6:33; Interrogation_Position=2109; Antisense; ATAAGATCGTTTTTGCAGAGCAGAG
>probe:Drosophila_2:1633777_at:208:265; Interrogation_Position=2129; Antisense; CAGAGAAGTCACTGCTCGACGGTTT
>probe:Drosophila_2:1633777_at:146:633; Interrogation_Position=2144; Antisense; TCGACGGTTTTTTCTGTTGTTCTGC
>probe:Drosophila_2:1633777_at:719:467; Interrogation_Position=2159; Antisense; GTTGTTCTGCGAGTGCAAATTGCCA

Paste this into a BLAST search page for me
TCAACCAGCGGGAGGGTCGTCTCTCATGAGAACAAGCTGCGCTTCAAGCGGCTTCAAGCGGATGATGTCCACCTAGATGTCCACCTACGGTCTGGATATATGGATATACCCATCGACCAGGCGATTGCGACGCCAACTTTGATCCGGACGTGATCCGGACGTGGAGAGTCTGCACGAGTCTGCACGCACTGGATCTGTTGATGTATATCATCATCCTGAACGGAAGAAACGGTTTGAATTTGTGGATCTAATAAGATCGTTTTTGCAGAGCAGAGCAGAGAAGTCACTGCTCGACGGTTTTCGACGGTTTTTTCTGTTGTTCTGCGTTGTTCTGCGAGTGCAAATTGCCA

Full Affymetrix probeset data:

Annotations for 1633777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720