Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633778_at:

>probe:Drosophila_2:1633778_at:260:111; Interrogation_Position=2031; Antisense; AGCACGATTGACTCGGTGACCTTCA
>probe:Drosophila_2:1633778_at:591:609; Interrogation_Position=2047; Antisense; TGACCTTCACTTGCCAGAAGCTCTT
>probe:Drosophila_2:1633778_at:328:109; Interrogation_Position=2062; Antisense; AGAAGCTCTTCATGTCCGCCAAAGA
>probe:Drosophila_2:1633778_at:272:549; Interrogation_Position=2093; Antisense; GGAGGACTAAACTGCCATCGAAATG
>probe:Drosophila_2:1633778_at:67:179; Interrogation_Position=2135; Antisense; AAAACGATCTAGCTATTTGGCCCTC
>probe:Drosophila_2:1633778_at:698:581; Interrogation_Position=2152; Antisense; TGGCCCTCCAAATAACTACCTATTA
>probe:Drosophila_2:1633778_at:569:387; Interrogation_Position=2210; Antisense; GAAAGCTTGGCTCGTTAAACCTGAA
>probe:Drosophila_2:1633778_at:287:203; Interrogation_Position=2260; Antisense; AAGCGGAAAACATGACCTGTACATC
>probe:Drosophila_2:1633778_at:591:411; Interrogation_Position=2273; Antisense; GACCTGTACATCACAAGGACTGGAG
>probe:Drosophila_2:1633778_at:269:143; Interrogation_Position=2460; Antisense; ACTGTTTGCCAAAGGTGCGATATTC
>probe:Drosophila_2:1633778_at:213:459; Interrogation_Position=2478; Antisense; GATATTCAGGTCGATATTTGCCATA
>probe:Drosophila_2:1633778_at:441:479; Interrogation_Position=2510; Antisense; GTTTCATATAATCTTCTGTTGCTTA
>probe:Drosophila_2:1633778_at:441:715; Interrogation_Position=2546; Antisense; TTCGGTTATTGTTTTTGTCCCTCAT
>probe:Drosophila_2:1633778_at:134:599; Interrogation_Position=2561; Antisense; TGTCCCTCATTTTACTACCTAAGTG

Paste this into a BLAST search page for me
AGCACGATTGACTCGGTGACCTTCATGACCTTCACTTGCCAGAAGCTCTTAGAAGCTCTTCATGTCCGCCAAAGAGGAGGACTAAACTGCCATCGAAATGAAAACGATCTAGCTATTTGGCCCTCTGGCCCTCCAAATAACTACCTATTAGAAAGCTTGGCTCGTTAAACCTGAAAAGCGGAAAACATGACCTGTACATCGACCTGTACATCACAAGGACTGGAGACTGTTTGCCAAAGGTGCGATATTCGATATTCAGGTCGATATTTGCCATAGTTTCATATAATCTTCTGTTGCTTATTCGGTTATTGTTTTTGTCCCTCATTGTCCCTCATTTTACTACCTAAGTG

Full Affymetrix probeset data:

Annotations for 1633778_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime