Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633779_s_at:

>probe:Drosophila_2:1633779_s_at:710:519; Interrogation_Position=462; Antisense; GTGGCTACTACTCCGTCTGCATTGA
>probe:Drosophila_2:1633779_s_at:280:619; Interrogation_Position=479; Antisense; TGCATTGACAACCAGTTCTCCCGAT
>probe:Drosophila_2:1633779_s_at:602:333; Interrogation_Position=514; Antisense; GCTGGTCAACATCTATATCACGGTG
>probe:Drosophila_2:1633779_s_at:251:53; Interrogation_Position=596; Antisense; ATGCAAAACTTCACTGCCACCGTTG
>probe:Drosophila_2:1633779_s_at:660:729; Interrogation_Position=618; Antisense; TTGGCACTGTGGAGCGCAACATCAA
>probe:Drosophila_2:1633779_s_at:250:237; Interrogation_Position=681; Antisense; AATCGCGTGATTATGCGTTGCTCCT
>probe:Drosophila_2:1633779_s_at:102:723; Interrogation_Position=698; Antisense; TTGCTCCTGGACAACAATGCCTATA
>probe:Drosophila_2:1633779_s_at:456:11; Interrogation_Position=722; Antisense; ATTCAAACCTTCTCGATTAGCCAAA
>probe:Drosophila_2:1633779_s_at:457:3; Interrogation_Position=746; Antisense; ATTGTGGTATTCTTTGTGCGCAAAC
>probe:Drosophila_2:1633779_s_at:227:417; Interrogation_Position=787; Antisense; GAGCTCCAAAAGTCGCATCTAAGGC
>probe:Drosophila_2:1633779_s_at:405:203; Interrogation_Position=828; Antisense; AAGACTTCGCAACATGTTTCTAAAA
>probe:Drosophila_2:1633779_s_at:395:7; Interrogation_Position=852; Antisense; ATTCCATCCGCATTTCCAAGACATT
>probe:Drosophila_2:1633779_s_at:58:213; Interrogation_Position=869; Antisense; AAGACATTCATTCTATTCTACCTGC
>probe:Drosophila_2:1633779_s_at:132:605; Interrogation_Position=932; Antisense; TGATCAAGCGCAACTGAGCAGACTT

Paste this into a BLAST search page for me
GTGGCTACTACTCCGTCTGCATTGATGCATTGACAACCAGTTCTCCCGATGCTGGTCAACATCTATATCACGGTGATGCAAAACTTCACTGCCACCGTTGTTGGCACTGTGGAGCGCAACATCAAAATCGCGTGATTATGCGTTGCTCCTTTGCTCCTGGACAACAATGCCTATAATTCAAACCTTCTCGATTAGCCAAAATTGTGGTATTCTTTGTGCGCAAACGAGCTCCAAAAGTCGCATCTAAGGCAAGACTTCGCAACATGTTTCTAAAAATTCCATCCGCATTTCCAAGACATTAAGACATTCATTCTATTCTACCTGCTGATCAAGCGCAACTGAGCAGACTT

Full Affymetrix probeset data:

Annotations for 1633779_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime