FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633780_at:

>probe:Drosophila_2:1633780_at:472:203; Interrogation_Position=1006; Antisense; AACCATGGTGTTCTTTATTTTGCGA
>probe:Drosophila_2:1633780_at:200:685; Interrogation_Position=1034; Antisense; TATCGATCGATGCTATTTTCTCACA
>probe:Drosophila_2:1633780_at:104:17; Interrogation_Position=1048; Antisense; ATTTTCTCACAAACACTGCTGCATT
>probe:Drosophila_2:1633780_at:328:543; Interrogation_Position=1125; Antisense; GGATATTAAGTTCATGCTGGGCCAG
>probe:Drosophila_2:1633780_at:701:697; Interrogation_Position=1170; Antisense; TTTTATACTCCGTTTCGTAGCTCCA
>probe:Drosophila_2:1633780_at:295:717; Interrogation_Position=1183; Antisense; TTCGTAGCTCCACCAACTTTAGTGA
>probe:Drosophila_2:1633780_at:45:377; Interrogation_Position=1240; Antisense; GAAGAACACTCTTATTCCTCGTCTG
>probe:Drosophila_2:1633780_at:3:643; Interrogation_Position=1261; Antisense; TCTGTTCTCCACTTTATGGCCATTA
>probe:Drosophila_2:1633780_at:727:541; Interrogation_Position=1294; Antisense; GGATTACCCATTCTGGCAATACCTG
>probe:Drosophila_2:1633780_at:676:701; Interrogation_Position=1329; Antisense; TTACTACATTCATCAGAGACCCGGC
>probe:Drosophila_2:1633780_at:59:339; Interrogation_Position=1365; Antisense; GCTCTTTAGAGCCACCGATTGGTAT
>probe:Drosophila_2:1633780_at:272:149; Interrogation_Position=1455; Antisense; ACTTTTCGATCGCACCGAGGAGGTT
>probe:Drosophila_2:1633780_at:378:213; Interrogation_Position=947; Antisense; AAGAGGTGACCCTTGGCCTGATTGG
>probe:Drosophila_2:1633780_at:585:499; Interrogation_Position=982; Antisense; GTCTGCTCTCTTTACTTTTGTACAA

Paste this into a BLAST search page for me
AACCATGGTGTTCTTTATTTTGCGATATCGATCGATGCTATTTTCTCACAATTTTCTCACAAACACTGCTGCATTGGATATTAAGTTCATGCTGGGCCAGTTTTATACTCCGTTTCGTAGCTCCATTCGTAGCTCCACCAACTTTAGTGAGAAGAACACTCTTATTCCTCGTCTGTCTGTTCTCCACTTTATGGCCATTAGGATTACCCATTCTGGCAATACCTGTTACTACATTCATCAGAGACCCGGCGCTCTTTAGAGCCACCGATTGGTATACTTTTCGATCGCACCGAGGAGGTTAAGAGGTGACCCTTGGCCTGATTGGGTCTGCTCTCTTTACTTTTGTACAA

Full Affymetrix probeset data:

Annotations for 1633780_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720