FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633782_at:

>probe:Drosophila_2:1633782_at:715:377; Interrogation_Position=105; Antisense; GAAGCGACTACGCAGTGATCTCGGA
>probe:Drosophila_2:1633782_at:522:451; Interrogation_Position=121; Antisense; GATCTCGGAGATTCGGATGAACCCT
>probe:Drosophila_2:1633782_at:699:61; Interrogation_Position=13; Antisense; ATGTCCTCGCAAATGCAGTGTCACT
>probe:Drosophila_2:1633782_at:589:445; Interrogation_Position=136; Antisense; GATGAACCCTACATGTGTCCAATTT
>probe:Drosophila_2:1633782_at:516:417; Interrogation_Position=166; Antisense; GAGAATGTGCGACGACGCCAACCAG
>probe:Drosophila_2:1633782_at:114:139; Interrogation_Position=209; Antisense; ACGTCTTTTGCTACGACTGCATTCA
>probe:Drosophila_2:1633782_at:222:283; Interrogation_Position=225; Antisense; CTGCATTCAGAAGGCCATCGGAGAT
>probe:Drosophila_2:1633782_at:231:85; Interrogation_Position=29; Antisense; AGTGTCACTGTCGAGCATGCCGCCA
>probe:Drosophila_2:1633782_at:591:697; Interrogation_Position=333; Antisense; TTTCATCTATTTTTTGCCATCCCTT
>probe:Drosophila_2:1633782_at:195:441; Interrogation_Position=393; Antisense; GATGGAGAAGGACCCTACACCGAAC
>probe:Drosophila_2:1633782_at:588:483; Interrogation_Position=444; Antisense; GTATCTGTATCTGAGTCCAGACCCA
>probe:Drosophila_2:1633782_at:465:307; Interrogation_Position=475; Antisense; CCTTGGCAACTGTCCGAATCCGAAT
>probe:Drosophila_2:1633782_at:511:365; Interrogation_Position=503; Antisense; GAATCTCGAAATGCCCAACGCTAAT
>probe:Drosophila_2:1633782_at:528:597; Interrogation_Position=80; Antisense; TGTGCAGTCCACAGAAGCAGCCAGT

Paste this into a BLAST search page for me
GAAGCGACTACGCAGTGATCTCGGAGATCTCGGAGATTCGGATGAACCCTATGTCCTCGCAAATGCAGTGTCACTGATGAACCCTACATGTGTCCAATTTGAGAATGTGCGACGACGCCAACCAGACGTCTTTTGCTACGACTGCATTCACTGCATTCAGAAGGCCATCGGAGATAGTGTCACTGTCGAGCATGCCGCCATTTCATCTATTTTTTGCCATCCCTTGATGGAGAAGGACCCTACACCGAACGTATCTGTATCTGAGTCCAGACCCACCTTGGCAACTGTCCGAATCCGAATGAATCTCGAAATGCCCAACGCTAATTGTGCAGTCCACAGAAGCAGCCAGT

Full Affymetrix probeset data:

Annotations for 1633782_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720