FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633784_at:

>probe:Drosophila_2:1633784_at:414:661; Interrogation_Position=1859; Antisense; TAAACGCTTTGGTAAATATCCTGGC
>probe:Drosophila_2:1633784_at:673:683; Interrogation_Position=1875; Antisense; TATCCTGGCCATTGTTAAGCACTTT
>probe:Drosophila_2:1633784_at:39:421; Interrogation_Position=1954; Antisense; GAGCAGATACTCGACGTGGTGCGCA
>probe:Drosophila_2:1633784_at:284:519; Interrogation_Position=1969; Antisense; GTGGTGCGCAAGAACTACGACCTAA
>probe:Drosophila_2:1633784_at:42:673; Interrogation_Position=1984; Antisense; TACGACCTAACGCTCAAACTGCAGG
>probe:Drosophila_2:1633784_at:69:403; Interrogation_Position=2008; Antisense; GACTCCCTGGACCAATACGAACGTT
>probe:Drosophila_2:1633784_at:331:655; Interrogation_Position=2064; Antisense; TAAGTTGATGGTTCGCGATGTTGTC
>probe:Drosophila_2:1633784_at:646:293; Interrogation_Position=2079; Antisense; CGATGTTGTCAACGATACGCGCAAG
>probe:Drosophila_2:1633784_at:511:671; Interrogation_Position=2094; Antisense; TACGCGCAAGCACATCTACGGCTAT
>probe:Drosophila_2:1633784_at:229:71; Interrogation_Position=2126; Antisense; AGGCAGTATCTGTTATTCCGGACCA
>probe:Drosophila_2:1633784_at:695:395; Interrogation_Position=2152; Antisense; GAAATTCTCCTCAGTTCCTCTATGA
>probe:Drosophila_2:1633784_at:715:51; Interrogation_Position=2173; Antisense; ATGACATCCGTTTCGGCCGGTACAG
>probe:Drosophila_2:1633784_at:162:173; Interrogation_Position=2233; Antisense; AAAGCGTTGCCTTCTTTTGCTTAGT
>probe:Drosophila_2:1633784_at:370:163; Interrogation_Position=2282; Antisense; AAATCTCTGGATGCGTAAACTCGAT

Paste this into a BLAST search page for me
TAAACGCTTTGGTAAATATCCTGGCTATCCTGGCCATTGTTAAGCACTTTGAGCAGATACTCGACGTGGTGCGCAGTGGTGCGCAAGAACTACGACCTAATACGACCTAACGCTCAAACTGCAGGGACTCCCTGGACCAATACGAACGTTTAAGTTGATGGTTCGCGATGTTGTCCGATGTTGTCAACGATACGCGCAAGTACGCGCAAGCACATCTACGGCTATAGGCAGTATCTGTTATTCCGGACCAGAAATTCTCCTCAGTTCCTCTATGAATGACATCCGTTTCGGCCGGTACAGAAAGCGTTGCCTTCTTTTGCTTAGTAAATCTCTGGATGCGTAAACTCGAT

Full Affymetrix probeset data:

Annotations for 1633784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720