FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633785_at:

>probe:Drosophila_2:1633785_at:442:177; Interrogation_Position=1015; Antisense; AAACTGCTCGCCGTCTAGATATAAG
>probe:Drosophila_2:1633785_at:290:237; Interrogation_Position=517; Antisense; AATCTGGAGTCGATGGCTCTGTCGG
>probe:Drosophila_2:1633785_at:554:325; Interrogation_Position=611; Antisense; GCGACGATGCTACGCTGACTCAGCT
>probe:Drosophila_2:1633785_at:105:135; Interrogation_Position=683; Antisense; ACGCCTTTCACATCTACCAGGAGTT
>probe:Drosophila_2:1633785_at:534:181; Interrogation_Position=713; Antisense; AAAAGTTCAAGCCAACTCCGGCGCT
>probe:Drosophila_2:1633785_at:556:205; Interrogation_Position=749; Antisense; AAGCGGTCGTTCATTTGGGTCTGGA
>probe:Drosophila_2:1633785_at:51:305; Interrogation_Position=794; Antisense; CCGTTCTGCGTGAATCTCTGCTGAA
>probe:Drosophila_2:1633785_at:674:403; Interrogation_Position=829; Antisense; GACTACGACACGCTGATCAATCTGA
>probe:Drosophila_2:1633785_at:181:455; Interrogation_Position=843; Antisense; GATCAATCTGATGGTTCATGCCCAT
>probe:Drosophila_2:1633785_at:537:397; Interrogation_Position=882; Antisense; GACAGAGGCGATCACCCGGAATCTA
>probe:Drosophila_2:1633785_at:189:439; Interrogation_Position=915; Antisense; GAGGCAGTTCTATCCCAAGAGCGAC
>probe:Drosophila_2:1633785_at:239:103; Interrogation_Position=932; Antisense; AGAGCGACTTTGTCACCGATCTAGA
>probe:Drosophila_2:1633785_at:414:109; Interrogation_Position=959; Antisense; AGAAGTCAGCGGAGTTCGACCGCCT
>probe:Drosophila_2:1633785_at:77:285; Interrogation_Position=982; Antisense; CTGTGCCTGCAGTACGACGTCGAGG

Paste this into a BLAST search page for me
AAACTGCTCGCCGTCTAGATATAAGAATCTGGAGTCGATGGCTCTGTCGGGCGACGATGCTACGCTGACTCAGCTACGCCTTTCACATCTACCAGGAGTTAAAAGTTCAAGCCAACTCCGGCGCTAAGCGGTCGTTCATTTGGGTCTGGACCGTTCTGCGTGAATCTCTGCTGAAGACTACGACACGCTGATCAATCTGAGATCAATCTGATGGTTCATGCCCATGACAGAGGCGATCACCCGGAATCTAGAGGCAGTTCTATCCCAAGAGCGACAGAGCGACTTTGTCACCGATCTAGAAGAAGTCAGCGGAGTTCGACCGCCTCTGTGCCTGCAGTACGACGTCGAGG

Full Affymetrix probeset data:

Annotations for 1633785_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720