Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633789_at:

>probe:Drosophila_2:1633789_at:489:187; Interrogation_Position=101; Antisense; AACACTCCGAAAGTCAAGTTCAGCA
>probe:Drosophila_2:1633789_at:347:161; Interrogation_Position=139; Antisense; ACAAGTCACCTAGGTTATGTGCCAA
>probe:Drosophila_2:1633789_at:423:681; Interrogation_Position=154; Antisense; TATGTGCCAACTTCGAATACTCGGA
>probe:Drosophila_2:1633789_at:285:659; Interrogation_Position=18; Antisense; TAAGAATTCCGTTGCCTTGACGTGC
>probe:Drosophila_2:1633789_at:84:181; Interrogation_Position=234; Antisense; AAACAATGCGTTTTCCTATCTGCGA
>probe:Drosophila_2:1633789_at:270:161; Interrogation_Position=261; Antisense; AAAGATTCCCAACGTTCCTACAGAT
>probe:Drosophila_2:1633789_at:437:613; Interrogation_Position=311; Antisense; TGAAGTTGGCCATATTGTACATAAA
>probe:Drosophila_2:1633789_at:295:611; Interrogation_Position=35; Antisense; TGACGTGCGAATACTCAACCATGTA
>probe:Drosophila_2:1633789_at:318:253; Interrogation_Position=371; Antisense; CAAAAGGCGGATTTCGAGCCGAACT
>probe:Drosophila_2:1633789_at:9:3; Interrogation_Position=387; Antisense; AGCCGAACTTAAGCCGGTCAGTCGA
>probe:Drosophila_2:1633789_at:266:231; Interrogation_Position=457; Antisense; AATGTTCCATTGTCGACCAAGGGCC
>probe:Drosophila_2:1633789_at:663:319; Interrogation_Position=479; Antisense; GCCGCACGGGTTGGCCACAAGATGT
>probe:Drosophila_2:1633789_at:720:59; Interrogation_Position=500; Antisense; ATGTTTGGGCATCGGAACTTATTCC
>probe:Drosophila_2:1633789_at:465:609; Interrogation_Position=75; Antisense; TAATACTTCCAACATGTTCGACATG

Paste this into a BLAST search page for me
AACACTCCGAAAGTCAAGTTCAGCAACAAGTCACCTAGGTTATGTGCCAATATGTGCCAACTTCGAATACTCGGATAAGAATTCCGTTGCCTTGACGTGCAAACAATGCGTTTTCCTATCTGCGAAAAGATTCCCAACGTTCCTACAGATTGAAGTTGGCCATATTGTACATAAATGACGTGCGAATACTCAACCATGTACAAAAGGCGGATTTCGAGCCGAACTAGCCGAACTTAAGCCGGTCAGTCGAAATGTTCCATTGTCGACCAAGGGCCGCCGCACGGGTTGGCCACAAGATGTATGTTTGGGCATCGGAACTTATTCCTAATACTTCCAACATGTTCGACATG

Full Affymetrix probeset data:

Annotations for 1633789_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime