FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633790_at:

>probe:Drosophila_2:1633790_at:46:379; Interrogation_Position=2488; Antisense; GAACCGATAATACCTCCTTGAAGTT
>probe:Drosophila_2:1633790_at:53:441; Interrogation_Position=2535; Antisense; GATGGTATTTTCGATACTCCCACCT
>probe:Drosophila_2:1633790_at:181:727; Interrogation_Position=2559; Antisense; TTGGAACTCGCAGCTGTGGGACACT
>probe:Drosophila_2:1633790_at:224:157; Interrogation_Position=2579; Antisense; ACACTGGGTCAGCTTCGAGTACGAA
>probe:Drosophila_2:1633790_at:199:571; Interrogation_Position=2615; Antisense; GGCTAAAGATTTTGTGGCCGCCTTC
>probe:Drosophila_2:1633790_at:3:403; Interrogation_Position=2643; Antisense; GACTTTGTCCACGTCATGGAATGGC
>probe:Drosophila_2:1633790_at:19:565; Interrogation_Position=2660; Antisense; GGAATGGCCATCTATATTTAAGCGA
>probe:Drosophila_2:1633790_at:500:485; Interrogation_Position=2710; Antisense; GTAGGTATCCATTTACAATCGTACA
>probe:Drosophila_2:1633790_at:168:637; Interrogation_Position=2728; Antisense; TCGTACAAGATACTCCATCCATCAC
>probe:Drosophila_2:1633790_at:248:481; Interrogation_Position=2825; Antisense; GTTTGAGAATCCCATGAACGCAGAG
>probe:Drosophila_2:1633790_at:115:383; Interrogation_Position=2840; Antisense; GAACGCAGAGAATCCCATAATCGCA
>probe:Drosophila_2:1633790_at:421:253; Interrogation_Position=2875; Antisense; CAAACGCAGAGAATCCCACTAACGC
>probe:Drosophila_2:1633790_at:226:379; Interrogation_Position=2962; Antisense; GAAGCCTTAAAACTTTCATGACCCT
>probe:Drosophila_2:1633790_at:75:647; Interrogation_Position=2977; Antisense; TCATGACCCTATTACATTGCGGAAA

Paste this into a BLAST search page for me
GAACCGATAATACCTCCTTGAAGTTGATGGTATTTTCGATACTCCCACCTTTGGAACTCGCAGCTGTGGGACACTACACTGGGTCAGCTTCGAGTACGAAGGCTAAAGATTTTGTGGCCGCCTTCGACTTTGTCCACGTCATGGAATGGCGGAATGGCCATCTATATTTAAGCGAGTAGGTATCCATTTACAATCGTACATCGTACAAGATACTCCATCCATCACGTTTGAGAATCCCATGAACGCAGAGGAACGCAGAGAATCCCATAATCGCACAAACGCAGAGAATCCCACTAACGCGAAGCCTTAAAACTTTCATGACCCTTCATGACCCTATTACATTGCGGAAA

Full Affymetrix probeset data:

Annotations for 1633790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720