FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633791_at:

>probe:Drosophila_2:1633791_at:277:321; Interrogation_Position=1116; Antisense; GCCCTCTTATCGTGTTCAGCAACAA
>probe:Drosophila_2:1633791_at:365:85; Interrogation_Position=1151; Antisense; AGTGACTTCGTTTCCATCTTCCTGA
>probe:Drosophila_2:1633791_at:323:607; Interrogation_Position=1218; Antisense; TGATGAAGATCCGTCTTGGCCGCTT
>probe:Drosophila_2:1633791_at:28:725; Interrogation_Position=1233; Antisense; TTGGCCGCTTCGAGCAGTTCCAAAA
>probe:Drosophila_2:1633791_at:713:89; Interrogation_Position=1248; Antisense; AGTTCCAAAACGGTCACTGCGACGT
>probe:Drosophila_2:1633791_at:377:561; Interrogation_Position=1292; Antisense; GGAAGTCGTGGCCTGGATACCACAC
>probe:Drosophila_2:1633791_at:500:157; Interrogation_Position=1313; Antisense; ACACGAGCTCGACATGTGGTCAACT
>probe:Drosophila_2:1633791_at:161:577; Interrogation_Position=1411; Antisense; GGCGCTAGTCACGAACCTGATATCA
>probe:Drosophila_2:1633791_at:41:41; Interrogation_Position=1448; Antisense; ATCGACGTCGTCCAGCGAATTGAGC
>probe:Drosophila_2:1633791_at:567:135; Interrogation_Position=1473; Antisense; ACGCAGCTCGAACAGGTGGACTTCT
>probe:Drosophila_2:1633791_at:477:403; Interrogation_Position=1491; Antisense; GACTTCTGCCGGATGTGAATGCCAA
>probe:Drosophila_2:1633791_at:286:303; Interrogation_Position=1578; Antisense; CCGCTTTGGGCTCACTAAATGGACA
>probe:Drosophila_2:1633791_at:674:663; Interrogation_Position=1593; Antisense; TAAATGGACATACGCCTCAGGAAGA
>probe:Drosophila_2:1633791_at:427:459; Interrogation_Position=1656; Antisense; GTTGTATCACCTTTCGGAAGACCGA

Paste this into a BLAST search page for me
GCCCTCTTATCGTGTTCAGCAACAAAGTGACTTCGTTTCCATCTTCCTGATGATGAAGATCCGTCTTGGCCGCTTTTGGCCGCTTCGAGCAGTTCCAAAAAGTTCCAAAACGGTCACTGCGACGTGGAAGTCGTGGCCTGGATACCACACACACGAGCTCGACATGTGGTCAACTGGCGCTAGTCACGAACCTGATATCAATCGACGTCGTCCAGCGAATTGAGCACGCAGCTCGAACAGGTGGACTTCTGACTTCTGCCGGATGTGAATGCCAACCGCTTTGGGCTCACTAAATGGACATAAATGGACATACGCCTCAGGAAGAGTTGTATCACCTTTCGGAAGACCGA

Full Affymetrix probeset data:

Annotations for 1633791_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720