FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633793_at:

>probe:Drosophila_2:1633793_at:30:183; Interrogation_Position=4514; Antisense; AAAACTCGAGCTATCTACTCCAGCA
>probe:Drosophila_2:1633793_at:299:355; Interrogation_Position=4536; Antisense; GCACCCAGATGCGTTTTGAAGACTT
>probe:Drosophila_2:1633793_at:606:489; Interrogation_Position=4611; Antisense; GTACACTGAAACACTATTTGGGTCA
>probe:Drosophila_2:1633793_at:615:203; Interrogation_Position=4686; Antisense; AAGCCACAATTCAGCGTCACATATT
>probe:Drosophila_2:1633793_at:460:495; Interrogation_Position=4701; Antisense; GTCACATATTTTCTACCATACGTCA
>probe:Drosophila_2:1633793_at:487:181; Interrogation_Position=4736; Antisense; AAAAACTGCGTAACTCTGAGCTTCT
>probe:Drosophila_2:1633793_at:241:605; Interrogation_Position=4752; Antisense; TGAGCTTCTTTGAAAAACCCCACAA
>probe:Drosophila_2:1633793_at:73:105; Interrogation_Position=4788; Antisense; AGACACGATGACACACTTACTATAC
>probe:Drosophila_2:1633793_at:151:491; Interrogation_Position=4875; Antisense; GTACATTTTATATCACGCCCAAAGG
>probe:Drosophila_2:1633793_at:558:17; Interrogation_Position=4961; Antisense; ATTTATTAGACACGCGCTTGTCCCC
>probe:Drosophila_2:1633793_at:408:727; Interrogation_Position=4978; Antisense; TTGTCCCCAGTGAGGCAGCCTTCAG
>probe:Drosophila_2:1633793_at:680:125; Interrogation_Position=4994; Antisense; AGCCTTCAGCTCTTTTGCTTATACA
>probe:Drosophila_2:1633793_at:65:703; Interrogation_Position=5012; Antisense; TTATACACAACTTAGGGCGTTCCTT
>probe:Drosophila_2:1633793_at:311:259; Interrogation_Position=5047; Antisense; CACCCACTTTTATGAATCCAGTCTC

Paste this into a BLAST search page for me
AAAACTCGAGCTATCTACTCCAGCAGCACCCAGATGCGTTTTGAAGACTTGTACACTGAAACACTATTTGGGTCAAAGCCACAATTCAGCGTCACATATTGTCACATATTTTCTACCATACGTCAAAAAACTGCGTAACTCTGAGCTTCTTGAGCTTCTTTGAAAAACCCCACAAAGACACGATGACACACTTACTATACGTACATTTTATATCACGCCCAAAGGATTTATTAGACACGCGCTTGTCCCCTTGTCCCCAGTGAGGCAGCCTTCAGAGCCTTCAGCTCTTTTGCTTATACATTATACACAACTTAGGGCGTTCCTTCACCCACTTTTATGAATCCAGTCTC

Full Affymetrix probeset data:

Annotations for 1633793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720