FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633797_at:

>probe:Drosophila_2:1633797_at:449:137; Interrogation_Position=1048; Antisense; ACGAGCGCAGTCTACAATCCGATTG
>probe:Drosophila_2:1633797_at:84:601; Interrogation_Position=1073; Antisense; TGTACGGCATTAGCCATCCCAAGTA
>probe:Drosophila_2:1633797_at:198:625; Interrogation_Position=1089; Antisense; TCCCAAGTACCGCATAGTTCTCAAG
>probe:Drosophila_2:1633797_at:460:321; Interrogation_Position=1121; Antisense; GCCCTATGTGTGTGTTTGGCAATAC
>probe:Drosophila_2:1633797_at:701:389; Interrogation_Position=1183; Antisense; GAAACTACATCTGAGGCGGATTCAA
>probe:Drosophila_2:1633797_at:338:175; Interrogation_Position=1227; Antisense; AAACCAACGCAATTGCCTGCAAAGG
>probe:Drosophila_2:1633797_at:375:229; Interrogation_Position=856; Antisense; AATGTGAAATCCCTGCGGAGCTCTG
>probe:Drosophila_2:1633797_at:466:289; Interrogation_Position=871; Antisense; CGGAGCTCTGAGGATTGCGACAAAA
>probe:Drosophila_2:1633797_at:20:581; Interrogation_Position=912; Antisense; GGCCAAGGTGGCTCTAACTACCATC
>probe:Drosophila_2:1633797_at:496:271; Interrogation_Position=933; Antisense; CATCTCCCTATGGTTTATGGCATGG
>probe:Drosophila_2:1633797_at:580:679; Interrogation_Position=948; Antisense; TATGGCATGGACACCATACCTTGTC
>probe:Drosophila_2:1633797_at:603:27; Interrogation_Position=963; Antisense; ATACCTTGTCATTTGCTACTTCGGA
>probe:Drosophila_2:1633797_at:455:601; Interrogation_Position=976; Antisense; TGCTACTTCGGACTCTTCAAAATCG
>probe:Drosophila_2:1633797_at:539:183; Interrogation_Position=994; Antisense; AAAATCGACGGATTGACCCCACTGA

Paste this into a BLAST search page for me
ACGAGCGCAGTCTACAATCCGATTGTGTACGGCATTAGCCATCCCAAGTATCCCAAGTACCGCATAGTTCTCAAGGCCCTATGTGTGTGTTTGGCAATACGAAACTACATCTGAGGCGGATTCAAAAACCAACGCAATTGCCTGCAAAGGAATGTGAAATCCCTGCGGAGCTCTGCGGAGCTCTGAGGATTGCGACAAAAGGCCAAGGTGGCTCTAACTACCATCCATCTCCCTATGGTTTATGGCATGGTATGGCATGGACACCATACCTTGTCATACCTTGTCATTTGCTACTTCGGATGCTACTTCGGACTCTTCAAAATCGAAAATCGACGGATTGACCCCACTGA

Full Affymetrix probeset data:

Annotations for 1633797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720