FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633798_at:

>probe:Drosophila_2:1633798_at:335:421; Interrogation_Position=1278; Antisense; GAGCACTGCATAGAAAAGGATCCGA
>probe:Drosophila_2:1633798_at:162:393; Interrogation_Position=1301; Antisense; GAAAGGATCTAAATCGTCAACCGAC
>probe:Drosophila_2:1633798_at:578:179; Interrogation_Position=1332; Antisense; AAACATCGTCAGCAGTAGCCGCAGT
>probe:Drosophila_2:1633798_at:459:643; Interrogation_Position=1399; Antisense; TCAACATCAGCGACCAATGCAACAT
>probe:Drosophila_2:1633798_at:622:161; Interrogation_Position=1456; Antisense; AAATTTTGCTAAATGAGCCGCCGCG
>probe:Drosophila_2:1633798_at:356:609; Interrogation_Position=1469; Antisense; TGAGCCGCCGCGTTTTTTCGGTTTG
>probe:Drosophila_2:1633798_at:68:699; Interrogation_Position=1500; Antisense; TTTTGTTTAGTTTCGTAGGGCAGAG
>probe:Drosophila_2:1633798_at:183:663; Interrogation_Position=1606; Antisense; TAAAATTTCCATCAAGCCTGGCCGT
>probe:Drosophila_2:1633798_at:356:305; Interrogation_Position=1622; Antisense; CCTGGCCGTCGTCAAAAAATTGCAT
>probe:Drosophila_2:1633798_at:523:257; Interrogation_Position=1712; Antisense; CACTGCAATTTAGATGGCGCCGGTA
>probe:Drosophila_2:1633798_at:673:439; Interrogation_Position=1724; Antisense; GATGGCGCCGGTATACAATTTACTT
>probe:Drosophila_2:1633798_at:376:11; Interrogation_Position=1778; Antisense; ATTCTTGAAAGCATTGTTACCCGTT
>probe:Drosophila_2:1633798_at:331:5; Interrogation_Position=1790; Antisense; ATTGTTACCCGTTGTGCGTTAAGCA
>probe:Drosophila_2:1633798_at:21:509; Interrogation_Position=1803; Antisense; GTGCGTTAAGCAAACCCATAACTCT

Paste this into a BLAST search page for me
GAGCACTGCATAGAAAAGGATCCGAGAAAGGATCTAAATCGTCAACCGACAAACATCGTCAGCAGTAGCCGCAGTTCAACATCAGCGACCAATGCAACATAAATTTTGCTAAATGAGCCGCCGCGTGAGCCGCCGCGTTTTTTCGGTTTGTTTTGTTTAGTTTCGTAGGGCAGAGTAAAATTTCCATCAAGCCTGGCCGTCCTGGCCGTCGTCAAAAAATTGCATCACTGCAATTTAGATGGCGCCGGTAGATGGCGCCGGTATACAATTTACTTATTCTTGAAAGCATTGTTACCCGTTATTGTTACCCGTTGTGCGTTAAGCAGTGCGTTAAGCAAACCCATAACTCT

Full Affymetrix probeset data:

Annotations for 1633798_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720