FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633803_at:

>probe:Drosophila_2:1633803_at:358:343; Interrogation_Position=1307; Antisense; GCTTGGATCTCCGTGATGCAGCACA
>probe:Drosophila_2:1633803_at:464:47; Interrogation_Position=1352; Antisense; ATCCTGAAGCAGCACTGGTCTGTGT
>probe:Drosophila_2:1633803_at:447:601; Interrogation_Position=1374; Antisense; TGTATGGACGCAACTATTTCACCCG
>probe:Drosophila_2:1633803_at:689:17; Interrogation_Position=1389; Antisense; ATTTCACCCGCTACGATTATGAGGA
>probe:Drosophila_2:1633803_at:615:15; Interrogation_Position=1404; Antisense; ATTATGAGGAGTGCGCTTCCGATCC
>probe:Drosophila_2:1633803_at:366:275; Interrogation_Position=1419; Antisense; CTTCCGATCCTTGCAACGAGATGGT
>probe:Drosophila_2:1633803_at:208:375; Interrogation_Position=1456; Antisense; GAAGACCATAACTGCTCCGGAGTTC
>probe:Drosophila_2:1633803_at:407:429; Interrogation_Position=1475; Antisense; GAGTTCGTCGGCAAGAGCTATTCCA
>probe:Drosophila_2:1633803_at:724:223; Interrogation_Position=1523; Antisense; AAGGAGGCCGACAACTTCAGCTACA
>probe:Drosophila_2:1633803_at:338:157; Interrogation_Position=1545; Antisense; ACACAGATCCTGTCGACAAGTCGGT
>probe:Drosophila_2:1633803_at:90:391; Interrogation_Position=1576; Antisense; GAAACAGGGTCTGCGCATTGTGTTC
>probe:Drosophila_2:1633803_at:610:201; Interrogation_Position=1654; Antisense; AACCGTTCGCTTGTACATTGATTCC
>probe:Drosophila_2:1633803_at:364:329; Interrogation_Position=1710; Antisense; GCGTGATGCTGAAACCCTTGATCGA
>probe:Drosophila_2:1633803_at:730:649; Interrogation_Position=1794; Antisense; TCACGTAAAGAGTTCCTGTCAGCGA

Paste this into a BLAST search page for me
GCTTGGATCTCCGTGATGCAGCACAATCCTGAAGCAGCACTGGTCTGTGTTGTATGGACGCAACTATTTCACCCGATTTCACCCGCTACGATTATGAGGAATTATGAGGAGTGCGCTTCCGATCCCTTCCGATCCTTGCAACGAGATGGTGAAGACCATAACTGCTCCGGAGTTCGAGTTCGTCGGCAAGAGCTATTCCAAAGGAGGCCGACAACTTCAGCTACAACACAGATCCTGTCGACAAGTCGGTGAAACAGGGTCTGCGCATTGTGTTCAACCGTTCGCTTGTACATTGATTCCGCGTGATGCTGAAACCCTTGATCGATCACGTAAAGAGTTCCTGTCAGCGA

Full Affymetrix probeset data:

Annotations for 1633803_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720