Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633804_at:

>probe:Drosophila_2:1633804_at:573:375; Interrogation_Position=1002; Antisense; GAAGAGCATTTTTCGCCTAAGTCCT
>probe:Drosophila_2:1633804_at:664:315; Interrogation_Position=1016; Antisense; GCCTAAGTCCTCCTCAATGAGAGTC
>probe:Drosophila_2:1633804_at:400:203; Interrogation_Position=1048; Antisense; AACCAAGTCAAGTCACTAGGCCAGT
>probe:Drosophila_2:1633804_at:546:217; Interrogation_Position=1057; Antisense; AAGTCACTAGGCCAGTCAGTCAGTC
>probe:Drosophila_2:1633804_at:280:267; Interrogation_Position=1093; Antisense; CAGTCAGTCAGACAGTCAGTCGTTT
>probe:Drosophila_2:1633804_at:446:399; Interrogation_Position=1103; Antisense; GACAGTCAGTCGTTTGGTTCTTAAT
>probe:Drosophila_2:1633804_at:64:541; Interrogation_Position=1118; Antisense; GGTTCTTAATGCCATTGCCTATGTT
>probe:Drosophila_2:1633804_at:688:171; Interrogation_Position=1190; Antisense; AAAGTTGTTTGCATTTCGCTGTGTA
>probe:Drosophila_2:1633804_at:84:345; Interrogation_Position=1200; Antisense; GCATTTCGCTGTGTATTTCAAATTG
>probe:Drosophila_2:1633804_at:477:489; Interrogation_Position=1244; Antisense; GTAAGAACAAGTCGCCTCAAAACTA
>probe:Drosophila_2:1633804_at:266:373; Interrogation_Position=1341; Antisense; GAAGTTTGTGCAACATGGAGTTACT
>probe:Drosophila_2:1633804_at:555:429; Interrogation_Position=1358; Antisense; GAGTTACTTAAATCCACATTATTCT
>probe:Drosophila_2:1633804_at:459:323; Interrogation_Position=1428; Antisense; GCGAAAGCTGATTGAATGCAACCGA
>probe:Drosophila_2:1633804_at:490:455; Interrogation_Position=969; Antisense; GATACCCTATTTGCAATTGGAATGT

Paste this into a BLAST search page for me
GAAGAGCATTTTTCGCCTAAGTCCTGCCTAAGTCCTCCTCAATGAGAGTCAACCAAGTCAAGTCACTAGGCCAGTAAGTCACTAGGCCAGTCAGTCAGTCCAGTCAGTCAGACAGTCAGTCGTTTGACAGTCAGTCGTTTGGTTCTTAATGGTTCTTAATGCCATTGCCTATGTTAAAGTTGTTTGCATTTCGCTGTGTAGCATTTCGCTGTGTATTTCAAATTGGTAAGAACAAGTCGCCTCAAAACTAGAAGTTTGTGCAACATGGAGTTACTGAGTTACTTAAATCCACATTATTCTGCGAAAGCTGATTGAATGCAACCGAGATACCCTATTTGCAATTGGAATGT

Full Affymetrix probeset data:

Annotations for 1633804_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime