FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633806_at:

>probe:Drosophila_2:1633806_at:132:57; Interrogation_Position=16; Antisense; ATGAGGCCTCGCCATCGGTGGCCAT
>probe:Drosophila_2:1633806_at:174:523; Interrogation_Position=190; Antisense; GGGCCACCACCACTTGTGGGCTCTG
>probe:Drosophila_2:1633806_at:407:417; Interrogation_Position=225; Antisense; GAGCTATCCTTTGTTCTACCCAGCT
>probe:Drosophila_2:1633806_at:562:691; Interrogation_Position=234; Antisense; TTTGTTCTACCCAGCTGCGTGGCTG
>probe:Drosophila_2:1633806_at:712:289; Interrogation_Position=251; Antisense; CGTGGCTGCCATTCGGACGCTACAG
>probe:Drosophila_2:1633806_at:565:7; Interrogation_Position=261; Antisense; ATTCGGACGCTACAGCAACTCCATT
>probe:Drosophila_2:1633806_at:130:271; Interrogation_Position=28; Antisense; CATCGGTGGCCATTTCAGGTGGTGC
>probe:Drosophila_2:1633806_at:707:629; Interrogation_Position=280; Antisense; TCCATTCCCGTCCACATAGTGGCTG
>probe:Drosophila_2:1633806_at:92:633; Interrogation_Position=285; Antisense; TCCCGTCCACATAGTGGCTGCCTAG
>probe:Drosophila_2:1633806_at:628:521; Interrogation_Position=33; Antisense; GTGGCCATTTCAGGTGGTGCTCCTC
>probe:Drosophila_2:1633806_at:715:15; Interrogation_Position=39; Antisense; ATTTCAGGTGGTGCTCCTCCTTCTG
>probe:Drosophila_2:1633806_at:186:81; Interrogation_Position=44; Antisense; AGGTGGTGCTCCTCCTTCTGATCCA
>probe:Drosophila_2:1633806_at:215:713; Interrogation_Position=59; Antisense; TTCTGATCCACCTGGCGGCCGCGGG
>probe:Drosophila_2:1633806_at:42:291; Interrogation_Position=80; Antisense; CGGGTCAGATCCAGGATGCTGCCGA

Paste this into a BLAST search page for me
ATGAGGCCTCGCCATCGGTGGCCATGGGCCACCACCACTTGTGGGCTCTGGAGCTATCCTTTGTTCTACCCAGCTTTTGTTCTACCCAGCTGCGTGGCTGCGTGGCTGCCATTCGGACGCTACAGATTCGGACGCTACAGCAACTCCATTCATCGGTGGCCATTTCAGGTGGTGCTCCATTCCCGTCCACATAGTGGCTGTCCCGTCCACATAGTGGCTGCCTAGGTGGCCATTTCAGGTGGTGCTCCTCATTTCAGGTGGTGCTCCTCCTTCTGAGGTGGTGCTCCTCCTTCTGATCCATTCTGATCCACCTGGCGGCCGCGGGCGGGTCAGATCCAGGATGCTGCCGA

Full Affymetrix probeset data:

Annotations for 1633806_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720