FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633809_at:

>probe:Drosophila_2:1633809_at:295:57; Interrogation_Position=13; Antisense; ATGAGCTTGGCTCTGGCCGATGTCT
>probe:Drosophila_2:1633809_at:673:171; Interrogation_Position=140; Antisense; AACAGAACCAGCAGTATCCCCAAGT
>probe:Drosophila_2:1633809_at:292:483; Interrogation_Position=153; Antisense; GTATCCCCAAGTGGCACGACAGTTT
>probe:Drosophila_2:1633809_at:210:337; Interrogation_Position=214; Antisense; GCTCTGACCAGCCAGGGTTACGTAT
>probe:Drosophila_2:1633809_at:163:473; Interrogation_Position=230; Antisense; GTTACGTATTTGGAGCACCGTCGTC
>probe:Drosophila_2:1633809_at:253:101; Interrogation_Position=301; Antisense; AGAGTATCATCTGCTGCGGGATCGG
>probe:Drosophila_2:1633809_at:319:443; Interrogation_Position=31; Antisense; GATGTCTCACACCTGGATTACTCGA
>probe:Drosophila_2:1633809_at:379:545; Interrogation_Position=319; Antisense; GGATCGGCCACAGGTCGTTCCATAT
>probe:Drosophila_2:1633809_at:483:589; Interrogation_Position=356; Antisense; TGGATGCCAACTCGCTGAATCTCAA
>probe:Drosophila_2:1633809_at:689:691; Interrogation_Position=394; Antisense; TTTGGCATTGCTCCACTGAATGTGG
>probe:Drosophila_2:1633809_at:10:371; Interrogation_Position=411; Antisense; GAATGTGGCGCAACTTCCGCTGCAG
>probe:Drosophila_2:1633809_at:501:589; Interrogation_Position=44; Antisense; TGGATTACTCGATAGCACCCAGCAC
>probe:Drosophila_2:1633809_at:8:25; Interrogation_Position=447; Antisense; ATATGCCAGTGTGCCCAGAACCACG
>probe:Drosophila_2:1633809_at:444:133; Interrogation_Position=67; Antisense; ACCCAGCTGGGTTACTATCACTATC

Paste this into a BLAST search page for me
ATGAGCTTGGCTCTGGCCGATGTCTAACAGAACCAGCAGTATCCCCAAGTGTATCCCCAAGTGGCACGACAGTTTGCTCTGACCAGCCAGGGTTACGTATGTTACGTATTTGGAGCACCGTCGTCAGAGTATCATCTGCTGCGGGATCGGGATGTCTCACACCTGGATTACTCGAGGATCGGCCACAGGTCGTTCCATATTGGATGCCAACTCGCTGAATCTCAATTTGGCATTGCTCCACTGAATGTGGGAATGTGGCGCAACTTCCGCTGCAGTGGATTACTCGATAGCACCCAGCACATATGCCAGTGTGCCCAGAACCACGACCCAGCTGGGTTACTATCACTATC

Full Affymetrix probeset data:

Annotations for 1633809_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720