Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633810_at:

>probe:Drosophila_2:1633810_at:442:267; Interrogation_Position=3442; Antisense; CAGTGCCGCCTTCTCGAGAAAGAAA
>probe:Drosophila_2:1633810_at:25:179; Interrogation_Position=3500; Antisense; AAACATTGCTTCATTCGCGACTTTC
>probe:Drosophila_2:1633810_at:674:695; Interrogation_Position=3521; Antisense; TTTCCCATTTAAAGATCCTGCCTGC
>probe:Drosophila_2:1633810_at:188:483; Interrogation_Position=3624; Antisense; GTATTTCAATACCAACATCTCCACG
>probe:Drosophila_2:1633810_at:535:513; Interrogation_Position=3665; Antisense; GTGTAGCTGACTATGTACCGCACGC
>probe:Drosophila_2:1633810_at:193:5; Interrogation_Position=3693; Antisense; ATTGGTCCTAAGTTGGAGCGCCCTA
>probe:Drosophila_2:1633810_at:689:521; Interrogation_Position=3749; Antisense; GTGGCCTGCACTTCATAAAGCTTTA
>probe:Drosophila_2:1633810_at:251:147; Interrogation_Position=3777; Antisense; ACTATTTGAGACTGGCCACTGTCCA
>probe:Drosophila_2:1633810_at:700:375; Interrogation_Position=3827; Antisense; GAAGAAGACATTCCTCTGACGACAC
>probe:Drosophila_2:1633810_at:155:609; Interrogation_Position=3843; Antisense; TGACGACACCTTAGATAACCGACGG
>probe:Drosophila_2:1633810_at:498:525; Interrogation_Position=3866; Antisense; GGGAGTTTCCACTACCTGAGGGAGC
>probe:Drosophila_2:1633810_at:196:657; Interrogation_Position=3897; Antisense; TAATGAGGATGCTTGGCAGCCCCTG
>probe:Drosophila_2:1633810_at:221:125; Interrogation_Position=3914; Antisense; AGCCCCTGGCGGATGCTGATGAAGA
>probe:Drosophila_2:1633810_at:221:147; Interrogation_Position=3962; Antisense; ACTATGTGGGCCAACGGTGTCTACT

Paste this into a BLAST search page for me
CAGTGCCGCCTTCTCGAGAAAGAAAAAACATTGCTTCATTCGCGACTTTCTTTCCCATTTAAAGATCCTGCCTGCGTATTTCAATACCAACATCTCCACGGTGTAGCTGACTATGTACCGCACGCATTGGTCCTAAGTTGGAGCGCCCTAGTGGCCTGCACTTCATAAAGCTTTAACTATTTGAGACTGGCCACTGTCCAGAAGAAGACATTCCTCTGACGACACTGACGACACCTTAGATAACCGACGGGGGAGTTTCCACTACCTGAGGGAGCTAATGAGGATGCTTGGCAGCCCCTGAGCCCCTGGCGGATGCTGATGAAGAACTATGTGGGCCAACGGTGTCTACT

Full Affymetrix probeset data:

Annotations for 1633810_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime