Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633811_at:

>probe:Drosophila_2:1633811_at:343:179; Interrogation_Position=127; Antisense; AAACAGCGAGGCACAACTGGCGAGA
>probe:Drosophila_2:1633811_at:598:441; Interrogation_Position=15; Antisense; GATGTCACTCACCATCAAATTCGTG
>probe:Drosophila_2:1633811_at:297:359; Interrogation_Position=174; Antisense; GCAACAGGTATTCGAGGGACTCAAC
>probe:Drosophila_2:1633811_at:117:419; Interrogation_Position=202; Antisense; GAGCTGAGTCAATCGGCACCTGAAT
>probe:Drosophila_2:1633811_at:563:231; Interrogation_Position=240; Antisense; AATGAGCCTGCTGGGTTTACTGGGC
>probe:Drosophila_2:1633811_at:158:699; Interrogation_Position=255; Antisense; TTTACTGGGCGTTAGCACTGAATTC
>probe:Drosophila_2:1633811_at:298:31; Interrogation_Position=305; Antisense; ATAAGTTTGTCGAAGGTGCCACCCA
>probe:Drosophila_2:1633811_at:280:613; Interrogation_Position=332; Antisense; TGAAAGCCATGTTGTCTCCGACCAC
>probe:Drosophila_2:1633811_at:450:497; Interrogation_Position=345; Antisense; GTCTCCGACCACAATAGCTCGGGAA
>probe:Drosophila_2:1633811_at:430:171; Interrogation_Position=368; Antisense; AAAGTGAGCTCCTCGAGGCGATCGA
>probe:Drosophila_2:1633811_at:103:31; Interrogation_Position=396; Antisense; ATACATCGCTTCCACTGATATACAG
>probe:Drosophila_2:1633811_at:515:155; Interrogation_Position=417; Antisense; ACAGCAGCACGAAGCTCTCTTTATG
>probe:Drosophila_2:1633811_at:559:93; Interrogation_Position=45; Antisense; AGTTGTGGACACAGTTCCGCTTGAA
>probe:Drosophila_2:1633811_at:280:611; Interrogation_Position=66; Antisense; TGAACAACGTGGACCGGGAACGGCT

Paste this into a BLAST search page for me
AAACAGCGAGGCACAACTGGCGAGAGATGTCACTCACCATCAAATTCGTGGCAACAGGTATTCGAGGGACTCAACGAGCTGAGTCAATCGGCACCTGAATAATGAGCCTGCTGGGTTTACTGGGCTTTACTGGGCGTTAGCACTGAATTCATAAGTTTGTCGAAGGTGCCACCCATGAAAGCCATGTTGTCTCCGACCACGTCTCCGACCACAATAGCTCGGGAAAAAGTGAGCTCCTCGAGGCGATCGAATACATCGCTTCCACTGATATACAGACAGCAGCACGAAGCTCTCTTTATGAGTTGTGGACACAGTTCCGCTTGAATGAACAACGTGGACCGGGAACGGCT

Full Affymetrix probeset data:

Annotations for 1633811_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime