FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633812_at:

>probe:Drosophila_2:1633812_at:207:171; Interrogation_Position=119; Antisense; AAAGATCACGCTGGAAGATGCTGAA
>probe:Drosophila_2:1633812_at:586:97; Interrogation_Position=134; Antisense; AGATGCTGAAGCACAGCCGGGAATC
>probe:Drosophila_2:1633812_at:605:3; Interrogation_Position=15; Antisense; ATTGCAGAAAGTGTTTGATCGTCCA
>probe:Drosophila_2:1633812_at:47:565; Interrogation_Position=153; Antisense; GGAATCGATGATGGCACTGGAGTTA
>probe:Drosophila_2:1633812_at:317:355; Interrogation_Position=166; Antisense; GCACTGGAGTTAGGGCCGCTCGTCA
>probe:Drosophila_2:1633812_at:589:277; Interrogation_Position=203; Antisense; CTTTGGCCGCGGAGGATATTGCTGT
>probe:Drosophila_2:1633812_at:29:449; Interrogation_Position=31; Antisense; GATCGTCCAATATGAAACAGTACCT
>probe:Drosophila_2:1633812_at:527:23; Interrogation_Position=326; Antisense; ATATCCCAGAGGTGGATTTGGCGGC
>probe:Drosophila_2:1633812_at:97:569; Interrogation_Position=351; Antisense; GGCAGTGCATCAGCATCGGCGTCAG
>probe:Drosophila_2:1633812_at:23:117; Interrogation_Position=362; Antisense; AGCATCGGCGTCAGCTTCAGCCAGT
>probe:Drosophila_2:1633812_at:631:473; Interrogation_Position=413; Antisense; GTTAATCACTGTAATTGAGGCGAAA
>probe:Drosophila_2:1633812_at:326:611; Interrogation_Position=43; Antisense; TGAAACAGTACCTGGTGCTTGCCCT
>probe:Drosophila_2:1633812_at:610:567; Interrogation_Position=77; Antisense; GGCCATTCTGGCCATGATCAGCGGC
>probe:Drosophila_2:1633812_at:99:455; Interrogation_Position=92; Antisense; GATCAGCGGCCATCCTCTGGAGGAA

Paste this into a BLAST search page for me
AAAGATCACGCTGGAAGATGCTGAAAGATGCTGAAGCACAGCCGGGAATCATTGCAGAAAGTGTTTGATCGTCCAGGAATCGATGATGGCACTGGAGTTAGCACTGGAGTTAGGGCCGCTCGTCACTTTGGCCGCGGAGGATATTGCTGTGATCGTCCAATATGAAACAGTACCTATATCCCAGAGGTGGATTTGGCGGCGGCAGTGCATCAGCATCGGCGTCAGAGCATCGGCGTCAGCTTCAGCCAGTGTTAATCACTGTAATTGAGGCGAAATGAAACAGTACCTGGTGCTTGCCCTGGCCATTCTGGCCATGATCAGCGGCGATCAGCGGCCATCCTCTGGAGGAA

Full Affymetrix probeset data:

Annotations for 1633812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720