FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633814_at:

>probe:Drosophila_2:1633814_at:723:221; Interrogation_Position=1017; Antisense; AAGGGCTCGCTGTACTTCTTTAAGA
>probe:Drosophila_2:1633814_at:537:711; Interrogation_Position=1032; Antisense; TTCTTTAAGACACCCAAGGCTGGCG
>probe:Drosophila_2:1633814_at:249:545; Interrogation_Position=1082; Antisense; GGATCCGCAGTTGGAGGGCTCCACT
>probe:Drosophila_2:1633814_at:639:531; Interrogation_Position=1107; Antisense; GGTGGCTATTACTCGGACTGCATGC
>probe:Drosophila_2:1633814_at:453:563; Interrogation_Position=1156; Antisense; GGAATATGCAGACCGCCGACTGGTT
>probe:Drosophila_2:1633814_at:36:101; Interrogation_Position=1240; Antisense; AGAGCCCCACCCAGAATGGCAATGG
>probe:Drosophila_2:1633814_at:2:229; Interrogation_Position=1278; Antisense; AATGGTAGTTCCAGTGCCAGTGCCA
>probe:Drosophila_2:1633814_at:390:85; Interrogation_Position=1302; Antisense; AGTGCCAGTAGTAACAATCCCGCTT
>probe:Drosophila_2:1633814_at:46:141; Interrogation_Position=1350; Antisense; ACGGTCGTGGTCAATCGTTCGTAGT
>probe:Drosophila_2:1633814_at:455:567; Interrogation_Position=785; Antisense; GGCACATCTCTTTGGGCGAATCAAC
>probe:Drosophila_2:1633814_at:14:523; Interrogation_Position=853; Antisense; GGGCGTACAGTCAGTCCAAGCTGGC
>probe:Drosophila_2:1633814_at:179:153; Interrogation_Position=880; Antisense; ACATCCTGTTTACCCTCAAGCTGAG
>probe:Drosophila_2:1633814_at:33:129; Interrogation_Position=908; Antisense; CATCCTTAAGGACACCGGCGTAACG
>probe:Drosophila_2:1633814_at:194:195; Interrogation_Position=936; Antisense; AACTGTTGTCATCCGGGTGTGGTCC

Paste this into a BLAST search page for me
AAGGGCTCGCTGTACTTCTTTAAGATTCTTTAAGACACCCAAGGCTGGCGGGATCCGCAGTTGGAGGGCTCCACTGGTGGCTATTACTCGGACTGCATGCGGAATATGCAGACCGCCGACTGGTTAGAGCCCCACCCAGAATGGCAATGGAATGGTAGTTCCAGTGCCAGTGCCAAGTGCCAGTAGTAACAATCCCGCTTACGGTCGTGGTCAATCGTTCGTAGTGGCACATCTCTTTGGGCGAATCAACGGGCGTACAGTCAGTCCAAGCTGGCACATCCTGTTTACCCTCAAGCTGAGCATCCTTAAGGACACCGGCGTAACGAACTGTTGTCATCCGGGTGTGGTCC

Full Affymetrix probeset data:

Annotations for 1633814_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720