FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633815_at:

>probe:Drosophila_2:1633815_at:690:707; Interrogation_Position=3879; Antisense; TTAAAACACGCGATATACCCATAAT
>probe:Drosophila_2:1633815_at:79:595; Interrogation_Position=4039; Antisense; TGTGGCCAATACAAACAAACTCATT
>probe:Drosophila_2:1633815_at:483:241; Interrogation_Position=4099; Antisense; AATATTGCTGCATACCTAAGAAGGC
>probe:Drosophila_2:1633815_at:316:141; Interrogation_Position=4147; Antisense; ACGGCAATGGTATTCGTATTATTAT
>probe:Drosophila_2:1633815_at:388:453; Interrogation_Position=4185; Antisense; GATAAACAACATATACCCGTGTACC
>probe:Drosophila_2:1633815_at:367:291; Interrogation_Position=4202; Antisense; CGTGTACCCCACTTATACATACATA
>probe:Drosophila_2:1633815_at:591:151; Interrogation_Position=4218; Antisense; ACATACATACAGACCCTCATGAGGA
>probe:Drosophila_2:1633815_at:62:411; Interrogation_Position=4229; Antisense; GACCCTCATGAGGAACATGGCCGGT
>probe:Drosophila_2:1633815_at:198:267; Interrogation_Position=4244; Antisense; CATGGCCGGTCGGTAGGTAGTCCTA
>probe:Drosophila_2:1633815_at:440:673; Interrogation_Position=4257; Antisense; TAGGTAGTCCTACAAGCCCAAACTT
>probe:Drosophila_2:1633815_at:629:665; Interrogation_Position=4267; Antisense; TACAAGCCCAAACTTCGTACAATTT
>probe:Drosophila_2:1633815_at:37:1; Interrogation_Position=4288; Antisense; ATTTTACCTTTTCAACGTCTCAGTG
>probe:Drosophila_2:1633815_at:254:709; Interrogation_Position=4298; Antisense; TTCAACGTCTCAGTGTCTAACAAAA
>probe:Drosophila_2:1633815_at:90:483; Interrogation_Position=4333; Antisense; GTATTTCCGCAAGGAAGTTACCAAT

Paste this into a BLAST search page for me
TTAAAACACGCGATATACCCATAATTGTGGCCAATACAAACAAACTCATTAATATTGCTGCATACCTAAGAAGGCACGGCAATGGTATTCGTATTATTATGATAAACAACATATACCCGTGTACCCGTGTACCCCACTTATACATACATAACATACATACAGACCCTCATGAGGAGACCCTCATGAGGAACATGGCCGGTCATGGCCGGTCGGTAGGTAGTCCTATAGGTAGTCCTACAAGCCCAAACTTTACAAGCCCAAACTTCGTACAATTTATTTTACCTTTTCAACGTCTCAGTGTTCAACGTCTCAGTGTCTAACAAAAGTATTTCCGCAAGGAAGTTACCAAT

Full Affymetrix probeset data:

Annotations for 1633815_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720