Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633816_at:

>probe:Drosophila_2:1633816_at:126:331; Interrogation_Position=1190; Antisense; GCGGAGGTAACAAGCGGCACCATCT
>probe:Drosophila_2:1633816_at:466:129; Interrogation_Position=1208; Antisense; ACCATCTCGGCATTGGCTCCTGGAT
>probe:Drosophila_2:1633816_at:164:463; Interrogation_Position=1262; Antisense; GATTCAGCCAAGTCTACGCTGGCCA
>probe:Drosophila_2:1633816_at:313:373; Interrogation_Position=1358; Antisense; GAAGTGACGGCTTACAGCCACGCAA
>probe:Drosophila_2:1633816_at:106:357; Interrogation_Position=1379; Antisense; GCAACTTCGGCCCAGGAGGAATATG
>probe:Drosophila_2:1633816_at:217:207; Interrogation_Position=1412; Antisense; AAGCGGATCAACGTGATTCAGCCGA
>probe:Drosophila_2:1633816_at:270:463; Interrogation_Position=1426; Antisense; GATTCAGCCGAAAGTGATGCCGCAT
>probe:Drosophila_2:1633816_at:404:85; Interrogation_Position=1438; Antisense; AGTGATGCCGCATAGGGTACCCAGC
>probe:Drosophila_2:1633816_at:62:691; Interrogation_Position=1510; Antisense; TTTGGCGATGCCGTATCACTTTCAG
>probe:Drosophila_2:1633816_at:707:481; Interrogation_Position=1522; Antisense; GTATCACTTTCAGGGCCAGGCCACG
>probe:Drosophila_2:1633816_at:545:267; Interrogation_Position=1577; Antisense; CAGGAGCAGCCCGTTGACTTTTCGC
>probe:Drosophila_2:1633816_at:454:403; Interrogation_Position=1592; Antisense; GACTTTTCGCCCAAGAACAACTTCA
>probe:Drosophila_2:1633816_at:237:213; Interrogation_Position=1628; Antisense; AAGACGAGTCCCTTCGAGCTGACCG
>probe:Drosophila_2:1633816_at:72:411; Interrogation_Position=1643; Antisense; GAGCTGACCGGGAATTACGCCATGG

Paste this into a BLAST search page for me
GCGGAGGTAACAAGCGGCACCATCTACCATCTCGGCATTGGCTCCTGGATGATTCAGCCAAGTCTACGCTGGCCAGAAGTGACGGCTTACAGCCACGCAAGCAACTTCGGCCCAGGAGGAATATGAAGCGGATCAACGTGATTCAGCCGAGATTCAGCCGAAAGTGATGCCGCATAGTGATGCCGCATAGGGTACCCAGCTTTGGCGATGCCGTATCACTTTCAGGTATCACTTTCAGGGCCAGGCCACGCAGGAGCAGCCCGTTGACTTTTCGCGACTTTTCGCCCAAGAACAACTTCAAAGACGAGTCCCTTCGAGCTGACCGGAGCTGACCGGGAATTACGCCATGG

Full Affymetrix probeset data:

Annotations for 1633816_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime