FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633817_at:

>probe:Drosophila_2:1633817_at:481:23; Interrogation_Position=178; Antisense; ATATCCGCCGATGTTCTACGAAGAG
>probe:Drosophila_2:1633817_at:372:393; Interrogation_Position=203; Antisense; GAAAGATCCTTGTTACCGTGGCTGG
>probe:Drosophila_2:1633817_at:366:305; Interrogation_Position=218; Antisense; CCGTGGCTGGTTTGCATGATTGTGA
>probe:Drosophila_2:1633817_at:141:595; Interrogation_Position=238; Antisense; TGTGAACCGGTGAAGTGCTCCCGAT
>probe:Drosophila_2:1633817_at:532:451; Interrogation_Position=260; Antisense; GATCTGTGGTCATCGTGCCGGATAC
>probe:Drosophila_2:1633817_at:97:405; Interrogation_Position=313; Antisense; GACTACGATGTGGTTGTTCTTCCTG
>probe:Drosophila_2:1633817_at:35:719; Interrogation_Position=332; Antisense; TTCCTGGCGGATTAGCTGGCAACAA
>probe:Drosophila_2:1633817_at:288:445; Interrogation_Position=363; Antisense; GATGAACTCGTCTGCCGTTGGCGAT
>probe:Drosophila_2:1633817_at:140:443; Interrogation_Position=385; Antisense; GATGTGCTGCGTTGCCAGGAATCAA
>probe:Drosophila_2:1633817_at:342:371; Interrogation_Position=504; Antisense; GAAGCCCCAGCTGAAGGAACTTTAT
>probe:Drosophila_2:1633817_at:726:243; Interrogation_Position=570; Antisense; AATTACAAGTCGTGGTCCTGGCACT
>probe:Drosophila_2:1633817_at:320:355; Interrogation_Position=590; Antisense; GCACTACTTTTGACTTCGCCTTGAA
>probe:Drosophila_2:1633817_at:673:193; Interrogation_Position=626; Antisense; AACTGGTCGGAGCTGAAGTTGCCAA
>probe:Drosophila_2:1633817_at:624:579; Interrogation_Position=657; Antisense; GGCCAAGGCAATGCTCTGGACTTAT

Paste this into a BLAST search page for me
ATATCCGCCGATGTTCTACGAAGAGGAAAGATCCTTGTTACCGTGGCTGGCCGTGGCTGGTTTGCATGATTGTGATGTGAACCGGTGAAGTGCTCCCGATGATCTGTGGTCATCGTGCCGGATACGACTACGATGTGGTTGTTCTTCCTGTTCCTGGCGGATTAGCTGGCAACAAGATGAACTCGTCTGCCGTTGGCGATGATGTGCTGCGTTGCCAGGAATCAAGAAGCCCCAGCTGAAGGAACTTTATAATTACAAGTCGTGGTCCTGGCACTGCACTACTTTTGACTTCGCCTTGAAAACTGGTCGGAGCTGAAGTTGCCAAGGCCAAGGCAATGCTCTGGACTTAT

Full Affymetrix probeset data:

Annotations for 1633817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720