Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633818_at:

>probe:Drosophila_2:1633818_at:317:647; Interrogation_Position=1011; Antisense; TCATGTGGCGTATCCGGAGCCGGAA
>probe:Drosophila_2:1633818_at:313:125; Interrogation_Position=1028; Antisense; AGCCGGAACTGCTCGAAGTGCATCT
>probe:Drosophila_2:1633818_at:94:219; Interrogation_Position=1043; Antisense; AAGTGCATCTGGTGGGCCATAACCT
>probe:Drosophila_2:1633818_at:264:523; Interrogation_Position=1056; Antisense; GGGCCATAACCTGGAGAAGCGCTAT
>probe:Drosophila_2:1633818_at:446:377; Interrogation_Position=1071; Antisense; GAAGCGCTATGTCTGCGACATCTGC
>probe:Drosophila_2:1633818_at:162:643; Interrogation_Position=1091; Antisense; TCTGCCAGGCGTCGCTGAAGCGCAA
>probe:Drosophila_2:1633818_at:472:157; Interrogation_Position=1133; Antisense; ACAAACAGTCGCACAATCCGGAAAG
>probe:Drosophila_2:1633818_at:302:393; Interrogation_Position=1153; Antisense; GAAAGACCCTACATCTGCACCGTGT
>probe:Drosophila_2:1633818_at:458:421; Interrogation_Position=1201; Antisense; GAGCAACTGAGTCTGCACTTTGTCA
>probe:Drosophila_2:1633818_at:54:119; Interrogation_Position=1337; Antisense; AGCTAAACAGCCATGTGCGGCGCGA
>probe:Drosophila_2:1633818_at:32:623; Interrogation_Position=1352; Antisense; TGCGGCGCGAGAATGGTACCAGTAT
>probe:Drosophila_2:1633818_at:419:487; Interrogation_Position=1367; Antisense; GTACCAGTATGTTGCAACCCGTTGT
>probe:Drosophila_2:1633818_at:670:247; Interrogation_Position=1381; Antisense; CAACCCGTTGTCACGGAGGCAACAA
>probe:Drosophila_2:1633818_at:301:271; Interrogation_Position=1513; Antisense; CATCACATTGTGATCACCCAGCAGC

Paste this into a BLAST search page for me
TCATGTGGCGTATCCGGAGCCGGAAAGCCGGAACTGCTCGAAGTGCATCTAAGTGCATCTGGTGGGCCATAACCTGGGCCATAACCTGGAGAAGCGCTATGAAGCGCTATGTCTGCGACATCTGCTCTGCCAGGCGTCGCTGAAGCGCAAACAAACAGTCGCACAATCCGGAAAGGAAAGACCCTACATCTGCACCGTGTGAGCAACTGAGTCTGCACTTTGTCAAGCTAAACAGCCATGTGCGGCGCGATGCGGCGCGAGAATGGTACCAGTATGTACCAGTATGTTGCAACCCGTTGTCAACCCGTTGTCACGGAGGCAACAACATCACATTGTGATCACCCAGCAGC

Full Affymetrix probeset data:

Annotations for 1633818_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime