Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633820_at:

>probe:Drosophila_2:1633820_at:387:241; Interrogation_Position=572; Antisense; AATACTACCTGCTGCTAATGCCAAT
>probe:Drosophila_2:1633820_at:496:49; Interrogation_Position=589; Antisense; ATGCCAATCATTTGCTTTGTCCTGC
>probe:Drosophila_2:1633820_at:535:365; Interrogation_Position=643; Antisense; GAATCACTCAATGTGTCCTGGCACG
>probe:Drosophila_2:1633820_at:268:619; Interrogation_Position=677; Antisense; TGCTTCGATGGTGCCTCAGTCTCAA
>probe:Drosophila_2:1633820_at:450:641; Interrogation_Position=696; Antisense; TCTCAATCTCATCTGGACGGTCAAT
>probe:Drosophila_2:1633820_at:689:567; Interrogation_Position=739; Antisense; GGCATGCGGCCTTACGACAAGAACA
>probe:Drosophila_2:1633820_at:689:23; Interrogation_Position=763; Antisense; ATATGTCCAGTCGATCAGGGCTTCC
>probe:Drosophila_2:1633820_at:131:1; Interrogation_Position=779; Antisense; AGGGCTTCCTCATATTTTTCCGTGT
>probe:Drosophila_2:1633820_at:617:285; Interrogation_Position=840; Antisense; CTGGGACTACAAGAGCGCCGAGCTG
>probe:Drosophila_2:1633820_at:344:217; Interrogation_Position=868; Antisense; AAGTATTCGCAGGATGTGACCACCA
>probe:Drosophila_2:1633820_at:607:683; Interrogation_Position=897; Antisense; TATCGAATTCATGGCCTATTTGGGT
>probe:Drosophila_2:1633820_at:15:691; Interrogation_Position=915; Antisense; TTTGGGTTGGGCCTACGATCTAAAG
>probe:Drosophila_2:1633820_at:421:433; Interrogation_Position=939; Antisense; GAGTGTCTCACTGGATTTGGTCAAG
>probe:Drosophila_2:1633820_at:515:641; Interrogation_Position=979; Antisense; TCTGGCGATGGATCACATCCTGTTT

Paste this into a BLAST search page for me
AATACTACCTGCTGCTAATGCCAATATGCCAATCATTTGCTTTGTCCTGCGAATCACTCAATGTGTCCTGGCACGTGCTTCGATGGTGCCTCAGTCTCAATCTCAATCTCATCTGGACGGTCAATGGCATGCGGCCTTACGACAAGAACAATATGTCCAGTCGATCAGGGCTTCCAGGGCTTCCTCATATTTTTCCGTGTCTGGGACTACAAGAGCGCCGAGCTGAAGTATTCGCAGGATGTGACCACCATATCGAATTCATGGCCTATTTGGGTTTTGGGTTGGGCCTACGATCTAAAGGAGTGTCTCACTGGATTTGGTCAAGTCTGGCGATGGATCACATCCTGTTT

Full Affymetrix probeset data:

Annotations for 1633820_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime