Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633821_at:

>probe:Drosophila_2:1633821_at:311:473; Interrogation_Position=1124; Antisense; GTTCACGCCCGCCAACGGTGGTCGT
>probe:Drosophila_2:1633821_at:217:299; Interrogation_Position=1133; Antisense; CGCCAACGGTGGTCGTTCAAAAGCT
>probe:Drosophila_2:1633821_at:707:517; Interrogation_Position=1141; Antisense; GTGGTCGTTCAAAAGCTCGTTCTAT
>probe:Drosophila_2:1633821_at:515:535; Interrogation_Position=1143; Antisense; GGTCGTTCAAAAGCTCGTTCTATAG
>probe:Drosophila_2:1633821_at:594:473; Interrogation_Position=1147; Antisense; GTTCAAAAGCTCGTTCTATAGTTCA
>probe:Drosophila_2:1633821_at:641:173; Interrogation_Position=1152; Antisense; AAAGCTCGTTCTATAGTTCACTACA
>probe:Drosophila_2:1633821_at:654:337; Interrogation_Position=1155; Antisense; GCTCGTTCTATAGTTCACTACAATG
>probe:Drosophila_2:1633821_at:301:683; Interrogation_Position=1163; Antisense; TATAGTTCACTACAATGCCTTTCTT
>probe:Drosophila_2:1633821_at:601:473; Interrogation_Position=1167; Antisense; GTTCACTACAATGCCTTTCTTTTGC
>probe:Drosophila_2:1633821_at:283:147; Interrogation_Position=1171; Antisense; ACTACAATGCCTTTCTTTTGCAGCG
>probe:Drosophila_2:1633821_at:392:161; Interrogation_Position=1174; Antisense; ACAATGCCTTTCTTTTGCAGCGATC
>probe:Drosophila_2:1633821_at:126:235; Interrogation_Position=1176; Antisense; AATGCCTTTCTTTTGCAGCGATCGA
>probe:Drosophila_2:1633821_at:550:627; Interrogation_Position=1178; Antisense; TGCCTTTCTTTTGCAGCGATCGATC
>probe:Drosophila_2:1633821_at:543:713; Interrogation_Position=1183; Antisense; TTCTTTTGCAGCGATCGATCCGCAT

Paste this into a BLAST search page for me
GTTCACGCCCGCCAACGGTGGTCGTCGCCAACGGTGGTCGTTCAAAAGCTGTGGTCGTTCAAAAGCTCGTTCTATGGTCGTTCAAAAGCTCGTTCTATAGGTTCAAAAGCTCGTTCTATAGTTCAAAAGCTCGTTCTATAGTTCACTACAGCTCGTTCTATAGTTCACTACAATGTATAGTTCACTACAATGCCTTTCTTGTTCACTACAATGCCTTTCTTTTGCACTACAATGCCTTTCTTTTGCAGCGACAATGCCTTTCTTTTGCAGCGATCAATGCCTTTCTTTTGCAGCGATCGATGCCTTTCTTTTGCAGCGATCGATCTTCTTTTGCAGCGATCGATCCGCAT

Full Affymetrix probeset data:

Annotations for 1633821_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime