FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633822_at:

>probe:Drosophila_2:1633822_at:218:243; Interrogation_Position=155; Antisense; AATTTGGCAACGACACCCTGGTGGA
>probe:Drosophila_2:1633822_at:635:63; Interrogation_Position=184; Antisense; ATGTGGGCCGCAAAAGCTCTGGAAC
>probe:Drosophila_2:1633822_at:454:585; Interrogation_Position=203; Antisense; TGGAACACGCCGAGGTGCACTTTAA
>probe:Drosophila_2:1633822_at:216:617; Interrogation_Position=218; Antisense; TGCACTTTAATCTCATCACCAGCGT
>probe:Drosophila_2:1633822_at:243:669; Interrogation_Position=271; Antisense; TACGACGACCAGATATACGCCACTT
>probe:Drosophila_2:1633822_at:235:27; Interrogation_Position=285; Antisense; ATACGCCACTTTCCGGCAGGATTTT
>probe:Drosophila_2:1633822_at:682:465; Interrogation_Position=322; Antisense; GTTGGCCGGCTTACCGATGATATTC
>probe:Drosophila_2:1633822_at:17:445; Interrogation_Position=337; Antisense; GATGATATTCTCAAATCCGCCACGG
>probe:Drosophila_2:1633822_at:276:409; Interrogation_Position=406; Antisense; GACGATTACTCGTATGGCACCCTGA
>probe:Drosophila_2:1633822_at:237:51; Interrogation_Position=430; Antisense; ATGCGCGCCGATGCCAGCAGGGAAT
>probe:Drosophila_2:1633822_at:271:559; Interrogation_Position=462; Antisense; GGACAACTCTATCTTCGTGTTTCGC
>probe:Drosophila_2:1633822_at:413:581; Interrogation_Position=497; Antisense; TGGCCATCGAGATTGCCCGGAATCG
>probe:Drosophila_2:1633822_at:310:235; Interrogation_Position=590; Antisense; AATCCCTCGCTCTAGCTTAGATTAA
>probe:Drosophila_2:1633822_at:706:119; Interrogation_Position=639; Antisense; AGCTGCAGTTCGTCTATCTACTTTA

Paste this into a BLAST search page for me
AATTTGGCAACGACACCCTGGTGGAATGTGGGCCGCAAAAGCTCTGGAACTGGAACACGCCGAGGTGCACTTTAATGCACTTTAATCTCATCACCAGCGTTACGACGACCAGATATACGCCACTTATACGCCACTTTCCGGCAGGATTTTGTTGGCCGGCTTACCGATGATATTCGATGATATTCTCAAATCCGCCACGGGACGATTACTCGTATGGCACCCTGAATGCGCGCCGATGCCAGCAGGGAATGGACAACTCTATCTTCGTGTTTCGCTGGCCATCGAGATTGCCCGGAATCGAATCCCTCGCTCTAGCTTAGATTAAAGCTGCAGTTCGTCTATCTACTTTA

Full Affymetrix probeset data:

Annotations for 1633822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720