Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633823_at:

>probe:Drosophila_2:1633823_at:682:295; Interrogation_Position=1011; Antisense; CGAATCAATCCAGGCTCTTCTATGG
>probe:Drosophila_2:1633823_at:119:703; Interrogation_Position=1028; Antisense; TTCTATGGACTACCTCAACCGGCAG
>probe:Drosophila_2:1633823_at:597:181; Interrogation_Position=1091; Antisense; AAAACCTTTTCATCTCCATACGTCG
>probe:Drosophila_2:1633823_at:441:305; Interrogation_Position=1189; Antisense; CCATCGATTGGTTTGCACGGGAAAG
>probe:Drosophila_2:1633823_at:713:611; Interrogation_Position=1240; Antisense; TGACAAATTTCAAGGCTACGCCGAA
>probe:Drosophila_2:1633823_at:113:671; Interrogation_Position=1256; Antisense; TACGCCGAATCCCTGGAAGCAAACA
>probe:Drosophila_2:1633823_at:501:221; Interrogation_Position=1280; Antisense; AAGGGTCACCGCTAGAAAAGATTCT
>probe:Drosophila_2:1633823_at:498:233; Interrogation_Position=810; Antisense; AATGCGTTTCAGTTCCGGAGCAGAC
>probe:Drosophila_2:1633823_at:110:103; Interrogation_Position=831; Antisense; AGACCTGTGCCCGATTTCGAGCGAT
>probe:Drosophila_2:1633823_at:49:39; Interrogation_Position=854; Antisense; ATCTCATCGTCGTTTGGAAAGGCGC
>probe:Drosophila_2:1633823_at:497:227; Interrogation_Position=872; Antisense; AAGGCGCAAGCTGTACCTGAACTCT
>probe:Drosophila_2:1633823_at:128:613; Interrogation_Position=889; Antisense; TGAACTCTCTGCAAACGGTGACGAA
>probe:Drosophila_2:1633823_at:249:581; Interrogation_Position=934; Antisense; TGGCCACGTCAATGGTCGCTTTAAA
>probe:Drosophila_2:1633823_at:651:567; Interrogation_Position=979; Antisense; GGCAGAGCCGAAAGACATCCGACTT

Paste this into a BLAST search page for me
CGAATCAATCCAGGCTCTTCTATGGTTCTATGGACTACCTCAACCGGCAGAAAACCTTTTCATCTCCATACGTCGCCATCGATTGGTTTGCACGGGAAAGTGACAAATTTCAAGGCTACGCCGAATACGCCGAATCCCTGGAAGCAAACAAAGGGTCACCGCTAGAAAAGATTCTAATGCGTTTCAGTTCCGGAGCAGACAGACCTGTGCCCGATTTCGAGCGATATCTCATCGTCGTTTGGAAAGGCGCAAGGCGCAAGCTGTACCTGAACTCTTGAACTCTCTGCAAACGGTGACGAATGGCCACGTCAATGGTCGCTTTAAAGGCAGAGCCGAAAGACATCCGACTT

Full Affymetrix probeset data:

Annotations for 1633823_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime