Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633825_at:

>probe:Drosophila_2:1633825_at:446:109; Interrogation_Position=1235; Antisense; AGAAGGATCTCGCTATTCTGCTCGA
>probe:Drosophila_2:1633825_at:300:689; Interrogation_Position=1248; Antisense; TATTCTGCTCGAGACGTGTCGCGAG
>probe:Drosophila_2:1633825_at:409:597; Interrogation_Position=1264; Antisense; TGTCGCGAGGACATTCCGCTCTATG
>probe:Drosophila_2:1633825_at:257:297; Interrogation_Position=1280; Antisense; CGCTCTATGGCTTCTTTAACGGTGA
>probe:Drosophila_2:1633825_at:99:661; Interrogation_Position=1296; Antisense; TAACGGTGACAATCCGCTGACGGCG
>probe:Drosophila_2:1633825_at:264:575; Interrogation_Position=1317; Antisense; GGCGCAATTTATAGCAAACTCCGTG
>probe:Drosophila_2:1633825_at:724:487; Interrogation_Position=1347; Antisense; GTACAATGCCAAGCCGTATGTTCCT
>probe:Drosophila_2:1633825_at:42:319; Interrogation_Position=1359; Antisense; GCCGTATGTTCCTACCGACAAGATT
>probe:Drosophila_2:1633825_at:492:221; Interrogation_Position=1399; Antisense; AAGGTGAACAGTCCGACCATTCCCA
>probe:Drosophila_2:1633825_at:287:669; Interrogation_Position=1447; Antisense; TACGTTAGCGCCAACTCGGTGGTGG
>probe:Drosophila_2:1633825_at:487:311; Interrogation_Position=1501; Antisense; GCCAACTACAAGTCTGCGCTGCAGG
>probe:Drosophila_2:1633825_at:539:527; Interrogation_Position=1599; Antisense; GGGAGAACATTCCAGCTCACTTCCG
>probe:Drosophila_2:1633825_at:276:149; Interrogation_Position=1617; Antisense; ACTTCCGTTGATTCCGTTGCAGAAT
>probe:Drosophila_2:1633825_at:146:427; Interrogation_Position=1777; Antisense; GAGAGTCGTCCTGCCACAGCGGATG

Paste this into a BLAST search page for me
AGAAGGATCTCGCTATTCTGCTCGATATTCTGCTCGAGACGTGTCGCGAGTGTCGCGAGGACATTCCGCTCTATGCGCTCTATGGCTTCTTTAACGGTGATAACGGTGACAATCCGCTGACGGCGGGCGCAATTTATAGCAAACTCCGTGGTACAATGCCAAGCCGTATGTTCCTGCCGTATGTTCCTACCGACAAGATTAAGGTGAACAGTCCGACCATTCCCATACGTTAGCGCCAACTCGGTGGTGGGCCAACTACAAGTCTGCGCTGCAGGGGGAGAACATTCCAGCTCACTTCCGACTTCCGTTGATTCCGTTGCAGAATGAGAGTCGTCCTGCCACAGCGGATG

Full Affymetrix probeset data:

Annotations for 1633825_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime