FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633826_at:

>probe:Drosophila_2:1633826_at:108:13; Interrogation_Position=1239; Antisense; ATTCAAAGCGACTGTGCCGTGCGCA
>probe:Drosophila_2:1633826_at:483:427; Interrogation_Position=1300; Antisense; GAGTTCCTTCGAAAGCAGGTTACGC
>probe:Drosophila_2:1633826_at:685:631; Interrogation_Position=1350; Antisense; TCCCAGGAATCCGTGACCTTGGAAT
>probe:Drosophila_2:1633826_at:643:17; Interrogation_Position=1376; Antisense; ATTTAATCAACTCCTGGCGATCGTG
>probe:Drosophila_2:1633826_at:535:207; Interrogation_Position=1432; Antisense; AAGCAGTCCGAGATTACCCAATGGT
>probe:Drosophila_2:1633826_at:659:485; Interrogation_Position=1467; Antisense; GTAGTAGCTGTGTGCGCAGCCATAT
>probe:Drosophila_2:1633826_at:398:273; Interrogation_Position=1487; Antisense; CATATTGCTGGTCGCCTTACTTGTT
>probe:Drosophila_2:1633826_at:391:127; Interrogation_Position=1505; Antisense; ACTTGTTTCGGCGACCTGGTTATAT
>probe:Drosophila_2:1633826_at:80:541; Interrogation_Position=1522; Antisense; GGTTATATCGCACCCATCGGAGCAA
>probe:Drosophila_2:1633826_at:606:189; Interrogation_Position=1549; Antisense; AACTTGCGCAGGCTCAAAATCTTGT
>probe:Drosophila_2:1633826_at:567:493; Interrogation_Position=1572; Antisense; GTCAACGAAGTCAATGGTCTCCAGG
>probe:Drosophila_2:1633826_at:42:537; Interrogation_Position=1587; Antisense; GGTCTCCAGGATCCACAGAATCGCA
>probe:Drosophila_2:1633826_at:445:615; Interrogation_Position=1620; Antisense; TGCAATCTTCCGCTGCTGGAAAAAC
>probe:Drosophila_2:1633826_at:76:329; Interrogation_Position=1676; Antisense; GCGTGGTGCATCTGTTAAGTTCCGA

Paste this into a BLAST search page for me
ATTCAAAGCGACTGTGCCGTGCGCAGAGTTCCTTCGAAAGCAGGTTACGCTCCCAGGAATCCGTGACCTTGGAATATTTAATCAACTCCTGGCGATCGTGAAGCAGTCCGAGATTACCCAATGGTGTAGTAGCTGTGTGCGCAGCCATATCATATTGCTGGTCGCCTTACTTGTTACTTGTTTCGGCGACCTGGTTATATGGTTATATCGCACCCATCGGAGCAAAACTTGCGCAGGCTCAAAATCTTGTGTCAACGAAGTCAATGGTCTCCAGGGGTCTCCAGGATCCACAGAATCGCATGCAATCTTCCGCTGCTGGAAAAACGCGTGGTGCATCTGTTAAGTTCCGA

Full Affymetrix probeset data:

Annotations for 1633826_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720