FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633827_at:

>probe:Drosophila_2:1633827_at:477:651; Interrogation_Position=123; Antisense; TAAAAGACCTGTGTTGTTTCGATTA
>probe:Drosophila_2:1633827_at:13:639; Interrogation_Position=152; Antisense; TTCGTTTAGGCCACTTGAAAAGACA
>probe:Drosophila_2:1633827_at:207:661; Interrogation_Position=232; Antisense; TAACCTGGATGAAACGTCTGCTGGA
>probe:Drosophila_2:1633827_at:428:685; Interrogation_Position=266; Antisense; TTACTAGCCTTTAAGGGACCCCATG
>probe:Drosophila_2:1633827_at:183:221; Interrogation_Position=278; Antisense; AAGGGACCCCATGCCGGATTTGTGG
>probe:Drosophila_2:1633827_at:285:693; Interrogation_Position=296; Antisense; TTTGTGGGTCTCAAGGTTCGCACTC
>probe:Drosophila_2:1633827_at:724:355; Interrogation_Position=315; Antisense; GCACTCCCAAGTTGCTGGGCCTAAA
>probe:Drosophila_2:1633827_at:351:595; Interrogation_Position=399; Antisense; TGGGCGCTGGATTAGCTGGATTAAC
>probe:Drosophila_2:1633827_at:190:461; Interrogation_Position=417; Antisense; GATTAACAAGCCATGCTGGTGGTCT
>probe:Drosophila_2:1633827_at:206:215; Interrogation_Position=47; Antisense; AAGATACAAGCTTCGTCATCGGCCC
>probe:Drosophila_2:1633827_at:659:113; Interrogation_Position=557; Antisense; AGCAGCGGCTACGAACACCATGAGT
>probe:Drosophila_2:1633827_at:92:55; Interrogation_Position=576; Antisense; ATGAGTACCACGAAAGCCACCACAG
>probe:Drosophila_2:1633827_at:506:127; Interrogation_Position=590; Antisense; AGCCACCACAGTGAAGGATCCAGTT
>probe:Drosophila_2:1633827_at:538:39; Interrogation_Position=64; Antisense; ATCGGCCCACACAGTTGAACTTGAA

Paste this into a BLAST search page for me
TAAAAGACCTGTGTTGTTTCGATTATTCGTTTAGGCCACTTGAAAAGACATAACCTGGATGAAACGTCTGCTGGATTACTAGCCTTTAAGGGACCCCATGAAGGGACCCCATGCCGGATTTGTGGTTTGTGGGTCTCAAGGTTCGCACTCGCACTCCCAAGTTGCTGGGCCTAAATGGGCGCTGGATTAGCTGGATTAACGATTAACAAGCCATGCTGGTGGTCTAAGATACAAGCTTCGTCATCGGCCCAGCAGCGGCTACGAACACCATGAGTATGAGTACCACGAAAGCCACCACAGAGCCACCACAGTGAAGGATCCAGTTATCGGCCCACACAGTTGAACTTGAA

Full Affymetrix probeset data:

Annotations for 1633827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720