FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633830_at:

>probe:Drosophila_2:1633830_at:191:679; Interrogation_Position=1074; Antisense; TAGGGCTCGTTCAAAGCATCTGCAT
>probe:Drosophila_2:1633830_at:150:347; Interrogation_Position=1089; Antisense; GCATCTGCATCGCTATACCTATGGT
>probe:Drosophila_2:1633830_at:217:305; Interrogation_Position=1106; Antisense; CCTATGGTCCTGGTGTTCGAAACTT
>probe:Drosophila_2:1633830_at:510:549; Interrogation_Position=1131; Antisense; GGAGTTAAATATTGCGCCGCCAAAT
>probe:Drosophila_2:1633830_at:15:229; Interrogation_Position=1153; Antisense; AATGGACACTTGAAACCGCTGAAAT
>probe:Drosophila_2:1633830_at:581:331; Interrogation_Position=1197; Antisense; GCTGTAATCACATTCCGTAGCTGGA
>probe:Drosophila_2:1633830_at:76:413; Interrogation_Position=1230; Antisense; GACCCCAGCTGCTAAGCTCTGATAA
>probe:Drosophila_2:1633830_at:279:659; Interrogation_Position=1313; Antisense; TAAGCGGCTTTAGCTGGCCATCAAA
>probe:Drosophila_2:1633830_at:6:697; Interrogation_Position=1338; Antisense; TTATCACGACGGTGTCTCCTAAGAG
>probe:Drosophila_2:1633830_at:71:365; Interrogation_Position=910; Antisense; GAATTTGCCATCAAGCGCAGCGGAT
>probe:Drosophila_2:1633830_at:33:383; Interrogation_Position=938; Antisense; GAACGACCATGTTCTTGCCGATTGG
>probe:Drosophila_2:1633830_at:194:5; Interrogation_Position=958; Antisense; ATTGGTTATAACTGCCAGGGCTCTA
>probe:Drosophila_2:1633830_at:648:267; Interrogation_Position=973; Antisense; CAGGGCTCTATGGTTTTCGTCTTAC
>probe:Drosophila_2:1633830_at:534:581; Interrogation_Position=999; Antisense; TGGCGATGACTTCTATGTTCCCGAA

Paste this into a BLAST search page for me
TAGGGCTCGTTCAAAGCATCTGCATGCATCTGCATCGCTATACCTATGGTCCTATGGTCCTGGTGTTCGAAACTTGGAGTTAAATATTGCGCCGCCAAATAATGGACACTTGAAACCGCTGAAATGCTGTAATCACATTCCGTAGCTGGAGACCCCAGCTGCTAAGCTCTGATAATAAGCGGCTTTAGCTGGCCATCAAATTATCACGACGGTGTCTCCTAAGAGGAATTTGCCATCAAGCGCAGCGGATGAACGACCATGTTCTTGCCGATTGGATTGGTTATAACTGCCAGGGCTCTACAGGGCTCTATGGTTTTCGTCTTACTGGCGATGACTTCTATGTTCCCGAA

Full Affymetrix probeset data:

Annotations for 1633830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720