FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633831_at:

>probe:Drosophila_2:1633831_at:568:383; Interrogation_Position=105; Antisense; GAACTTCAAGTGCACATCCATGGCT
>probe:Drosophila_2:1633831_at:246:47; Interrogation_Position=120; Antisense; ATCCATGGCTAAGGACGTGGCCGAT
>probe:Drosophila_2:1633831_at:367:43; Interrogation_Position=173; Antisense; ATCGAACTTATCAATACCTCTCCAC
>probe:Drosophila_2:1633831_at:567:363; Interrogation_Position=237; Antisense; GAATTTTGGATTGCACCAGCAGATC
>probe:Drosophila_2:1633831_at:28:687; Interrogation_Position=268; Antisense; TATAAGCCCTTCCTATACAACATCA
>probe:Drosophila_2:1633831_at:330:189; Interrogation_Position=286; Antisense; AACATCACTATTGACGGTTGCCAAT
>probe:Drosophila_2:1633831_at:204:257; Interrogation_Position=323; Antisense; CAAAGTCCAATGTAGTCGCCAAATA
>probe:Drosophila_2:1633831_at:551:149; Interrogation_Position=377; Antisense; ACTTGAATCATTCCTGTCCGTACAA
>probe:Drosophila_2:1633831_at:635:501; Interrogation_Position=392; Antisense; GTCCGTACAACCACGACATTATAAT
>probe:Drosophila_2:1633831_at:591:655; Interrogation_Position=413; Antisense; TAATGGAGAAACTTACCTCTGAGAC
>probe:Drosophila_2:1633831_at:626:423; Interrogation_Position=433; Antisense; GAGACTATTAATTCCCGACTACCAA
>probe:Drosophila_2:1633831_at:227:179; Interrogation_Position=480; Antisense; AAACTACATGTTTCAGACCTATTGG
>probe:Drosophila_2:1633831_at:527:463; Interrogation_Position=504; Antisense; GATTGCCAATGAAAAGTACCGTGTG
>probe:Drosophila_2:1633831_at:630:459; Interrogation_Position=81; Antisense; GATTTATTCTCATATCGAGTTCACG

Paste this into a BLAST search page for me
GAACTTCAAGTGCACATCCATGGCTATCCATGGCTAAGGACGTGGCCGATATCGAACTTATCAATACCTCTCCACGAATTTTGGATTGCACCAGCAGATCTATAAGCCCTTCCTATACAACATCAAACATCACTATTGACGGTTGCCAATCAAAGTCCAATGTAGTCGCCAAATAACTTGAATCATTCCTGTCCGTACAAGTCCGTACAACCACGACATTATAATTAATGGAGAAACTTACCTCTGAGACGAGACTATTAATTCCCGACTACCAAAAACTACATGTTTCAGACCTATTGGGATTGCCAATGAAAAGTACCGTGTGGATTTATTCTCATATCGAGTTCACG

Full Affymetrix probeset data:

Annotations for 1633831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720