Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633832_a_at:

>probe:Drosophila_2:1633832_a_at:727:435; Interrogation_Position=102; Antisense; GAGGAGCAGCTATGCCGGACGAACT
>probe:Drosophila_2:1633832_a_at:648:555; Interrogation_Position=118; Antisense; GGACGAACTACTGCAACGGCCGGAG
>probe:Drosophila_2:1633832_a_at:203:613; Interrogation_Position=129; Antisense; TGCAACGGCCGGAGTACATGGACGT
>probe:Drosophila_2:1633832_a_at:362:557; Interrogation_Position=148; Antisense; GGACGTGGCAGCATTGGTACCATAA
>probe:Drosophila_2:1633832_a_at:540:237; Interrogation_Position=188; Antisense; AATCATTTCGGGAACGTTTCCTCAG
>probe:Drosophila_2:1633832_a_at:465:283; Interrogation_Position=20; Antisense; CTGCCGGCTGGCTTGATATGAATGC
>probe:Drosophila_2:1633832_a_at:685:197; Interrogation_Position=200; Antisense; AACGTTTCCTCAGCAACTCATCTGG
>probe:Drosophila_2:1633832_a_at:182:171; Interrogation_Position=254; Antisense; AAAGGGATGCCGAGTCTGGCAGAAT
>probe:Drosophila_2:1633832_a_at:690:377; Interrogation_Position=280; Antisense; GAAGCCAGTGGATCAAGTTCATCGG
>probe:Drosophila_2:1633832_a_at:21:517; Interrogation_Position=335; Antisense; GTGTCGAGGATCTCTTTGCCAATGA
>probe:Drosophila_2:1633832_a_at:537:311; Interrogation_Position=352; Antisense; GCCAATGAGGCAGAACGTCGCAATT
>probe:Drosophila_2:1633832_a_at:676:381; Interrogation_Position=364; Antisense; GAACGTCGCAATTGGCACAGGAAAA
>probe:Drosophila_2:1633832_a_at:485:615; Interrogation_Position=38; Antisense; TGAATGCAGCTCTTCAGAACCTCGA
>probe:Drosophila_2:1633832_a_at:388:643; Interrogation_Position=64; Antisense; TCTCCGCCGGAGACAGTGAAAAAGG

Paste this into a BLAST search page for me
GAGGAGCAGCTATGCCGGACGAACTGGACGAACTACTGCAACGGCCGGAGTGCAACGGCCGGAGTACATGGACGTGGACGTGGCAGCATTGGTACCATAAAATCATTTCGGGAACGTTTCCTCAGCTGCCGGCTGGCTTGATATGAATGCAACGTTTCCTCAGCAACTCATCTGGAAAGGGATGCCGAGTCTGGCAGAATGAAGCCAGTGGATCAAGTTCATCGGGTGTCGAGGATCTCTTTGCCAATGAGCCAATGAGGCAGAACGTCGCAATTGAACGTCGCAATTGGCACAGGAAAATGAATGCAGCTCTTCAGAACCTCGATCTCCGCCGGAGACAGTGAAAAAGG

Full Affymetrix probeset data:

Annotations for 1633832_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime