Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633833_at:

>probe:Drosophila_2:1633833_at:533:5; Interrogation_Position=2414; Antisense; ATTGTGCACTTCGTTGAGTTAACCG
>probe:Drosophila_2:1633833_at:481:173; Interrogation_Position=2481; Antisense; AAAGCCTTTGTGTAATCAGATGCAT
>probe:Drosophila_2:1633833_at:302:509; Interrogation_Position=2531; Antisense; GTGAATTGTCCAGAAGTCGACTCGG
>probe:Drosophila_2:1633833_at:111:503; Interrogation_Position=2546; Antisense; GTCGACTCGGAGTATCCCAAAATGG
>probe:Drosophila_2:1633833_at:193:183; Interrogation_Position=2564; Antisense; AAAATGGTTCTTGTCAGCTCTTCCT
>probe:Drosophila_2:1633833_at:86:727; Interrogation_Position=2574; Antisense; TTGTCAGCTCTTCCTTTATTTTAAA
>probe:Drosophila_2:1633833_at:161:663; Interrogation_Position=2595; Antisense; TAAAAAGACTTCAGATTCACGCGGA
>probe:Drosophila_2:1633833_at:131:463; Interrogation_Position=2608; Antisense; GATTCACGCGGAAGCTTTAATTGAT
>probe:Drosophila_2:1633833_at:132:101; Interrogation_Position=2638; Antisense; AGAGGCTTCATCTTTATACATGGAA
>probe:Drosophila_2:1633833_at:622:245; Interrogation_Position=2699; Antisense; AATTCATTTTTGACGATGCCACCAG
>probe:Drosophila_2:1633833_at:368:425; Interrogation_Position=2713; Antisense; GATGCCACCAGACCTTAAAAACTTT
>probe:Drosophila_2:1633833_at:523:371; Interrogation_Position=2752; Antisense; GAAGTGAATGACTTTTTCCCATTAT
>probe:Drosophila_2:1633833_at:40:727; Interrogation_Position=2881; Antisense; TTGTGTTGCAGCCAGCCAAACTATT
>probe:Drosophila_2:1633833_at:713:205; Interrogation_Position=2953; Antisense; AAGCGATCTTCGGTTATTCAACAAA

Paste this into a BLAST search page for me
ATTGTGCACTTCGTTGAGTTAACCGAAAGCCTTTGTGTAATCAGATGCATGTGAATTGTCCAGAAGTCGACTCGGGTCGACTCGGAGTATCCCAAAATGGAAAATGGTTCTTGTCAGCTCTTCCTTTGTCAGCTCTTCCTTTATTTTAAATAAAAAGACTTCAGATTCACGCGGAGATTCACGCGGAAGCTTTAATTGATAGAGGCTTCATCTTTATACATGGAAAATTCATTTTTGACGATGCCACCAGGATGCCACCAGACCTTAAAAACTTTGAAGTGAATGACTTTTTCCCATTATTTGTGTTGCAGCCAGCCAAACTATTAAGCGATCTTCGGTTATTCAACAAA

Full Affymetrix probeset data:

Annotations for 1633833_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime