Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633834_at:

>probe:Drosophila_2:1633834_at:705:639; Interrogation_Position=1437; Antisense; TCTGGAGGACTATGCCCGCGTGGAC
>probe:Drosophila_2:1633834_at:633:329; Interrogation_Position=1454; Antisense; GCGTGGACTACTACAATCTCTATCT
>probe:Drosophila_2:1633834_at:102:39; Interrogation_Position=1469; Antisense; ATCTCTATCTGTCGGCGGTTCTGGA
>probe:Drosophila_2:1633834_at:437:243; Interrogation_Position=1513; Antisense; AATATCAGTGGCTACATCGCCTGGA
>probe:Drosophila_2:1633834_at:357:45; Interrogation_Position=1528; Antisense; ATCGCCTGGAGTCTGATGGACAGCT
>probe:Drosophila_2:1633834_at:626:105; Interrogation_Position=1577; Antisense; AGAAATTCGGTCTCTATCATGTGGA
>probe:Drosophila_2:1633834_at:496:35; Interrogation_Position=1592; Antisense; ATCATGTGGACTTCAACTCACCGCA
>probe:Drosophila_2:1633834_at:35:727; Interrogation_Position=1683; Antisense; TTGGAGCTACAGACCCAAGCTGGAT
>probe:Drosophila_2:1633834_at:344:279; Interrogation_Position=1766; Antisense; CTAGCGGTGCTGTCAGTTGGAGTCT
>probe:Drosophila_2:1633834_at:412:499; Interrogation_Position=1787; Antisense; GTCTGATGGGCATTCTACTGCTGGC
>probe:Drosophila_2:1633834_at:645:669; Interrogation_Position=1802; Antisense; TACTGCTGGCTCTGCTTAGATAAGA
>probe:Drosophila_2:1633834_at:413:413; Interrogation_Position=1855; Antisense; GAGCCTTGCCATATTCGATTGCTAC
>probe:Drosophila_2:1633834_at:695:321; Interrogation_Position=1875; Antisense; GCTACTCGTATCTCTAAGTTCGTCT
>probe:Drosophila_2:1633834_at:37:471; Interrogation_Position=1892; Antisense; GTTCGTCTAACCGTCTTTGTAATAT

Paste this into a BLAST search page for me
TCTGGAGGACTATGCCCGCGTGGACGCGTGGACTACTACAATCTCTATCTATCTCTATCTGTCGGCGGTTCTGGAAATATCAGTGGCTACATCGCCTGGAATCGCCTGGAGTCTGATGGACAGCTAGAAATTCGGTCTCTATCATGTGGAATCATGTGGACTTCAACTCACCGCATTGGAGCTACAGACCCAAGCTGGATCTAGCGGTGCTGTCAGTTGGAGTCTGTCTGATGGGCATTCTACTGCTGGCTACTGCTGGCTCTGCTTAGATAAGAGAGCCTTGCCATATTCGATTGCTACGCTACTCGTATCTCTAAGTTCGTCTGTTCGTCTAACCGTCTTTGTAATAT

Full Affymetrix probeset data:

Annotations for 1633834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime