Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633836_a_at:

>probe:Drosophila_2:1633836_a_at:374:619; Interrogation_Position=1012; Antisense; TGCATCTGCATCTAAACACCAACAC
>probe:Drosophila_2:1633836_a_at:77:487; Interrogation_Position=1054; Antisense; GTAGTTTGTGTGTCTGTAACCCCGG
>probe:Drosophila_2:1633836_a_at:139:341; Interrogation_Position=1066; Antisense; TCTGTAACCCCGGTACTAGACGTAG
>probe:Drosophila_2:1633836_a_at:43:689; Interrogation_Position=1152; Antisense; TATATATTTTGTGTCGGCTGCGGGT
>probe:Drosophila_2:1633836_a_at:628:531; Interrogation_Position=1174; Antisense; GGTGGTGACGATTTTTAGACCCATC
>probe:Drosophila_2:1633836_a_at:553:239; Interrogation_Position=1233; Antisense; AATCAGACACACTCTCAAGACGAAG
>probe:Drosophila_2:1633836_a_at:389:437; Interrogation_Position=725; Antisense; GAGGAGATCTTTCAGCACGAGGATA
>probe:Drosophila_2:1633836_a_at:527:657; Interrogation_Position=754; Antisense; TAAGAACGGTTTCATCTCGCACGAT
>probe:Drosophila_2:1633836_a_at:176:351; Interrogation_Position=772; Antisense; GCACGATGAGTTCTCGGGACCCAAA
>probe:Drosophila_2:1633836_a_at:174:645; Interrogation_Position=829; Antisense; TCTTGGTTTGCCGTCAACATCGAAG
>probe:Drosophila_2:1633836_a_at:239:527; Interrogation_Position=853; Antisense; GGGACACGAGTGCTTAAGTTATATA
>probe:Drosophila_2:1633836_a_at:34:687; Interrogation_Position=908; Antisense; TATACAACAGATGAGGCACGAGCCG
>probe:Drosophila_2:1633836_a_at:126:433; Interrogation_Position=944; Antisense; GAGTGCAACCAAATGCTTCCCGATG
>probe:Drosophila_2:1633836_a_at:392:51; Interrogation_Position=956; Antisense; ATGCTTCCCGATGTCATTTTGTATA

Paste this into a BLAST search page for me
TGCATCTGCATCTAAACACCAACACGTAGTTTGTGTGTCTGTAACCCCGGTCTGTAACCCCGGTACTAGACGTAGTATATATTTTGTGTCGGCTGCGGGTGGTGGTGACGATTTTTAGACCCATCAATCAGACACACTCTCAAGACGAAGGAGGAGATCTTTCAGCACGAGGATATAAGAACGGTTTCATCTCGCACGATGCACGATGAGTTCTCGGGACCCAAATCTTGGTTTGCCGTCAACATCGAAGGGGACACGAGTGCTTAAGTTATATATATACAACAGATGAGGCACGAGCCGGAGTGCAACCAAATGCTTCCCGATGATGCTTCCCGATGTCATTTTGTATA

Full Affymetrix probeset data:

Annotations for 1633836_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime