FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633837_at:

>probe:Drosophila_2:1633837_at:246:495; Interrogation_Position=112; Antisense; GTCAAGGACTGCTGTGTCTATCCCA
>probe:Drosophila_2:1633837_at:527:163; Interrogation_Position=172; Antisense; AAATATATGCCAGTTGGTGCTCCCA
>probe:Drosophila_2:1633837_at:141:109; Interrogation_Position=196; Antisense; AGAATTTCACCCTGCCTCTATGAAT
>probe:Drosophila_2:1633837_at:561:555; Interrogation_Position=249; Antisense; GGACGGAGCTATTCATCCTGACAAT
>probe:Drosophila_2:1633837_at:715:161; Interrogation_Position=269; Antisense; ACAATGCCCGACTCATGCTGGAGAA
>probe:Drosophila_2:1633837_at:558:621; Interrogation_Position=32; Antisense; TGCTGATCTGCTCATTGCTAGCGAT
>probe:Drosophila_2:1633837_at:726:655; Interrogation_Position=338; Antisense; TAATGGGCTGTTCGGATTCTGTGCA
>probe:Drosophila_2:1633837_at:17:13; Interrogation_Position=370; Antisense; ATTAGCAACAGGAGGTCACGGCCCC
>probe:Drosophila_2:1633837_at:383:59; Interrogation_Position=455; Antisense; ATGTCTTCAACCATTGTCCATCATC
>probe:Drosophila_2:1633837_at:100:537; Interrogation_Position=485; Antisense; GGTCCGGCACTGAATCTTGCGAAAT
>probe:Drosophila_2:1633837_at:454:393; Interrogation_Position=505; Antisense; GAAATGGCCCGATTGCAGAACATGA
>probe:Drosophila_2:1633837_at:668:383; Interrogation_Position=528; Antisense; GAACTGTTCGAAACCATCACGTGGT
>probe:Drosophila_2:1633837_at:296:441; Interrogation_Position=54; Antisense; GATGGCTGGCTGTGATCCAATCGAT
>probe:Drosophila_2:1633837_at:64:141; Interrogation_Position=546; Antisense; ACGTGGTTCTAGTCATCGCCTTTAA

Paste this into a BLAST search page for me
GTCAAGGACTGCTGTGTCTATCCCAAAATATATGCCAGTTGGTGCTCCCAAGAATTTCACCCTGCCTCTATGAATGGACGGAGCTATTCATCCTGACAATACAATGCCCGACTCATGCTGGAGAATGCTGATCTGCTCATTGCTAGCGATTAATGGGCTGTTCGGATTCTGTGCAATTAGCAACAGGAGGTCACGGCCCCATGTCTTCAACCATTGTCCATCATCGGTCCGGCACTGAATCTTGCGAAATGAAATGGCCCGATTGCAGAACATGAGAACTGTTCGAAACCATCACGTGGTGATGGCTGGCTGTGATCCAATCGATACGTGGTTCTAGTCATCGCCTTTAA

Full Affymetrix probeset data:

Annotations for 1633837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720