FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633839_at:

>probe:Drosophila_2:1633839_at:115:453; Interrogation_Position=1194; Antisense; GATCTACTGTGTGTACGTGTTCCGG
>probe:Drosophila_2:1633839_at:77:297; Interrogation_Position=1223; Antisense; CGAAGACGCCATCGCAGGTGCGCAA
>probe:Drosophila_2:1633839_at:168:199; Interrogation_Position=1246; Antisense; AACGAGGATCTCTACTGGACGCGGC
>probe:Drosophila_2:1633839_at:159:143; Interrogation_Position=1259; Antisense; ACTGGACGCGGCACTGGCAGAAGAA
>probe:Drosophila_2:1633839_at:225:211; Interrogation_Position=1279; Antisense; AAGAATATCGGATACACGCCGCAGG
>probe:Drosophila_2:1633839_at:86:667; Interrogation_Position=1291; Antisense; TACACGCCGCAGGAGATCAACTACA
>probe:Drosophila_2:1633839_at:166:559; Interrogation_Position=1320; Antisense; GGACAAGTACGATGCCTACTCGGAT
>probe:Drosophila_2:1633839_at:21:147; Interrogation_Position=1337; Antisense; ACTCGGATCGCTATTCGGTTAGCAA
>probe:Drosophila_2:1633839_at:89:165; Interrogation_Position=1372; Antisense; AAATACTCGGATCGCGAGAGCCAGC
>probe:Drosophila_2:1633839_at:207:425; Interrogation_Position=1387; Antisense; GAGAGCCAGCGATACTGATTGTTAT
>probe:Drosophila_2:1633839_at:640:197; Interrogation_Position=1572; Antisense; AACGTACCTGCTGCAAGTTGCTTGC
>probe:Drosophila_2:1633839_at:458:93; Interrogation_Position=1587; Antisense; AGTTGCTTGCTGGTTTGTATGTTTT
>probe:Drosophila_2:1633839_at:476:165; Interrogation_Position=1619; Antisense; AAACTGACGGGAGACGCGAACGCGA
>probe:Drosophila_2:1633839_at:43:431; Interrogation_Position=1654; Antisense; GAGTATTGTAATCTGCCATATTTGA

Paste this into a BLAST search page for me
GATCTACTGTGTGTACGTGTTCCGGCGAAGACGCCATCGCAGGTGCGCAAAACGAGGATCTCTACTGGACGCGGCACTGGACGCGGCACTGGCAGAAGAAAAGAATATCGGATACACGCCGCAGGTACACGCCGCAGGAGATCAACTACAGGACAAGTACGATGCCTACTCGGATACTCGGATCGCTATTCGGTTAGCAAAAATACTCGGATCGCGAGAGCCAGCGAGAGCCAGCGATACTGATTGTTATAACGTACCTGCTGCAAGTTGCTTGCAGTTGCTTGCTGGTTTGTATGTTTTAAACTGACGGGAGACGCGAACGCGAGAGTATTGTAATCTGCCATATTTGA

Full Affymetrix probeset data:

Annotations for 1633839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720